ID: 1175334271

View in Genome Browser
Species Human (GRCh38)
Location 20:58184979-58185001
Sequence AATGAAATGAAGGTGGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175334271_1175334275 1 Left 1175334271 20:58184979-58185001 CCTGCAGCCACCTTCATTTCATT No data
Right 1175334275 20:58185003-58185025 ATGAAACCATTTAGGCCTTCTGG No data
1175334271_1175334277 13 Left 1175334271 20:58184979-58185001 CCTGCAGCCACCTTCATTTCATT No data
Right 1175334277 20:58185015-58185037 AGGCCTTCTGGCCTCTAGAACGG No data
1175334271_1175334278 14 Left 1175334271 20:58184979-58185001 CCTGCAGCCACCTTCATTTCATT No data
Right 1175334278 20:58185016-58185038 GGCCTTCTGGCCTCTAGAACGGG No data
1175334271_1175334274 -7 Left 1175334271 20:58184979-58185001 CCTGCAGCCACCTTCATTTCATT No data
Right 1175334274 20:58184995-58185017 TTTCATTCATGAAACCATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175334271 Original CRISPR AATGAAATGAAGGTGGCTGC AGG (reversed) Intergenic
No off target data available for this crispr