ID: 1175334573

View in Genome Browser
Species Human (GRCh38)
Location 20:58186877-58186899
Sequence CGTCTGGATGGAGCAGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175334573_1175334579 2 Left 1175334573 20:58186877-58186899 CCTGCAGCTGCTCCATCCAGACG No data
Right 1175334579 20:58186902-58186924 GCAGGCCAAGCATGTGGTTTAGG No data
1175334573_1175334581 19 Left 1175334573 20:58186877-58186899 CCTGCAGCTGCTCCATCCAGACG No data
Right 1175334581 20:58186919-58186941 TTTAGGTGCAAAGAAAAAAATGG No data
1175334573_1175334578 -4 Left 1175334573 20:58186877-58186899 CCTGCAGCTGCTCCATCCAGACG No data
Right 1175334578 20:58186896-58186918 GACGGAGCAGGCCAAGCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175334573 Original CRISPR CGTCTGGATGGAGCAGCTGC AGG (reversed) Intergenic
No off target data available for this crispr