ID: 1175336050

View in Genome Browser
Species Human (GRCh38)
Location 20:58197082-58197104
Sequence CTCCCACTCCACCCCGTCAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175336032_1175336050 28 Left 1175336032 20:58197031-58197053 CCATCTTACCACCACCCCGTCAC No data
Right 1175336050 20:58197082-58197104 CTCCCACTCCACCCCGTCACCGG No data
1175336043_1175336050 6 Left 1175336043 20:58197053-58197075 CCGGGGCCACCTCTCCTGGGCCT No data
Right 1175336050 20:58197082-58197104 CTCCCACTCCACCCCGTCACCGG No data
1175336036_1175336050 20 Left 1175336036 20:58197039-58197061 CCACCACCCCGTCACCGGGGCCA No data
Right 1175336050 20:58197082-58197104 CTCCCACTCCACCCCGTCACCGG No data
1175336039_1175336050 13 Left 1175336039 20:58197046-58197068 CCCGTCACCGGGGCCACCTCTCC No data
Right 1175336050 20:58197082-58197104 CTCCCACTCCACCCCGTCACCGG No data
1175336040_1175336050 12 Left 1175336040 20:58197047-58197069 CCGTCACCGGGGCCACCTCTCCT No data
Right 1175336050 20:58197082-58197104 CTCCCACTCCACCCCGTCACCGG No data
1175336038_1175336050 14 Left 1175336038 20:58197045-58197067 CCCCGTCACCGGGGCCACCTCTC No data
Right 1175336050 20:58197082-58197104 CTCCCACTCCACCCCGTCACCGG No data
1175336037_1175336050 17 Left 1175336037 20:58197042-58197064 CCACCCCGTCACCGGGGCCACCT No data
Right 1175336050 20:58197082-58197104 CTCCCACTCCACCCCGTCACCGG No data
1175336045_1175336050 -3 Left 1175336045 20:58197062-58197084 CCTCTCCTGGGCCTCCTCCTCTC No data
Right 1175336050 20:58197082-58197104 CTCCCACTCCACCCCGTCACCGG No data
1175336044_1175336050 0 Left 1175336044 20:58197059-58197081 CCACCTCTCCTGGGCCTCCTCCT No data
Right 1175336050 20:58197082-58197104 CTCCCACTCCACCCCGTCACCGG No data
1175336046_1175336050 -8 Left 1175336046 20:58197067-58197089 CCTGGGCCTCCTCCTCTCCCACT No data
Right 1175336050 20:58197082-58197104 CTCCCACTCCACCCCGTCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175336050 Original CRISPR CTCCCACTCCACCCCGTCAC CGG Intergenic
No off target data available for this crispr