ID: 1175338174

View in Genome Browser
Species Human (GRCh38)
Location 20:58210049-58210071
Sequence CGACGCCGGCAGGCCCGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175338162_1175338174 30 Left 1175338162 20:58209996-58210018 CCGTGGCCGCGCACCTGCGGCAA No data
Right 1175338174 20:58210049-58210071 CGACGCCGGCAGGCCCGGAGAGG No data
1175338164_1175338174 17 Left 1175338164 20:58210009-58210031 CCTGCGGCAACTGCGTTCGACAG No data
Right 1175338174 20:58210049-58210071 CGACGCCGGCAGGCCCGGAGAGG No data
1175338163_1175338174 24 Left 1175338163 20:58210002-58210024 CCGCGCACCTGCGGCAACTGCGT No data
Right 1175338174 20:58210049-58210071 CGACGCCGGCAGGCCCGGAGAGG No data
1175338168_1175338174 -8 Left 1175338168 20:58210034-58210056 CCACCTGGCGGGAGCCGACGCCG No data
Right 1175338174 20:58210049-58210071 CGACGCCGGCAGGCCCGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175338174 Original CRISPR CGACGCCGGCAGGCCCGGAG AGG Intergenic
No off target data available for this crispr