ID: 1175338529

View in Genome Browser
Species Human (GRCh38)
Location 20:58212593-58212615
Sequence GACAGTCATGAGGAGTATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175338529_1175338537 7 Left 1175338529 20:58212593-58212615 CCCAGATACTCCTCATGACTGTC No data
Right 1175338537 20:58212623-58212645 CTGTACATACAGATCAAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175338529 Original CRISPR GACAGTCATGAGGAGTATCT GGG (reversed) Intergenic
No off target data available for this crispr