ID: 1175338530

View in Genome Browser
Species Human (GRCh38)
Location 20:58212594-58212616
Sequence GGACAGTCATGAGGAGTATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175338530_1175338537 6 Left 1175338530 20:58212594-58212616 CCAGATACTCCTCATGACTGTCC No data
Right 1175338537 20:58212623-58212645 CTGTACATACAGATCAAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175338530 Original CRISPR GGACAGTCATGAGGAGTATC TGG (reversed) Intergenic
No off target data available for this crispr