ID: 1175338537

View in Genome Browser
Species Human (GRCh38)
Location 20:58212623-58212645
Sequence CTGTACATACAGATCAAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175338529_1175338537 7 Left 1175338529 20:58212593-58212615 CCCAGATACTCCTCATGACTGTC No data
Right 1175338537 20:58212623-58212645 CTGTACATACAGATCAAGTCAGG No data
1175338530_1175338537 6 Left 1175338530 20:58212594-58212616 CCAGATACTCCTCATGACTGTCC No data
Right 1175338537 20:58212623-58212645 CTGTACATACAGATCAAGTCAGG No data
1175338532_1175338537 -3 Left 1175338532 20:58212603-58212625 CCTCATGACTGTCCCCTGGCCTG No data
Right 1175338537 20:58212623-58212645 CTGTACATACAGATCAAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175338537 Original CRISPR CTGTACATACAGATCAAGTC AGG Intergenic
No off target data available for this crispr