ID: 1175340266

View in Genome Browser
Species Human (GRCh38)
Location 20:58224526-58224548
Sequence CAGTGGCCCTGGAGGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 537
Summary {0: 1, 1: 0, 2: 3, 3: 52, 4: 481}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175340266_1175340273 27 Left 1175340266 20:58224526-58224548 CCTGCTTCCCTCCAGGGCCACTG 0: 1
1: 0
2: 3
3: 52
4: 481
Right 1175340273 20:58224576-58224598 CAATTTGCTACCAGAAACTCAGG 0: 1
1: 0
2: 1
3: 7
4: 158
1175340266_1175340270 -8 Left 1175340266 20:58224526-58224548 CCTGCTTCCCTCCAGGGCCACTG 0: 1
1: 0
2: 3
3: 52
4: 481
Right 1175340270 20:58224541-58224563 GGCCACTGACTTCTCACTCTTGG 0: 1
1: 0
2: 2
3: 14
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175340266 Original CRISPR CAGTGGCCCTGGAGGGAAGC AGG (reversed) Intronic
900148350 1:1167851-1167873 CAGGGGCCCGGGAGGGACGTGGG - Intergenic
900156732 1:1206167-1206189 CAGTGGCCCCGGCCGGGAGCAGG - Intronic
900482592 1:2906404-2906426 CAGAGGCCCCTGAGGGATGCTGG - Intergenic
900490991 1:2949080-2949102 GGCTGGCCCTGGAGGGCAGCTGG - Intergenic
900535931 1:3177524-3177546 CAGCAGCCCTGGAGGGAAGGTGG - Intronic
900569051 1:3349421-3349443 AAGTGGCCATGGCGGGAAGCAGG + Intronic
900571699 1:3361828-3361850 CTGTGGCCCAGGAGGGCAGGTGG + Intronic
900571734 1:3361964-3361986 CCGTGGCCCAGGAGGGCAGGTGG + Intronic
900571743 1:3361997-3362019 CCGTGGCCCAGGAGGGCAGGTGG + Intronic
900760026 1:4464120-4464142 CAGTGGGGTTGGAGGGAAGGAGG - Intergenic
901209488 1:7516396-7516418 GAGGGGCCGTGGAGGGCAGCTGG + Intronic
901784162 1:11613566-11613588 CAGTGGACTTTGAGGAAAGCAGG - Intergenic
901972299 1:12917877-12917899 CAGGGACCCTAGAGGGAGGCGGG - Exonic
902012880 1:13283885-13283907 CAGGGACCCTAGAGGGAGGCGGG + Exonic
902337307 1:15760907-15760929 CAGTGGGACGGGAGGGAAGCCGG + Intronic
902923164 1:19679269-19679291 CAGCGGCCCTGGTGGGCAGCGGG - Exonic
903133975 1:21297203-21297225 CAGAGGCCCTGGGGGGCACCGGG + Intronic
903263229 1:22142523-22142545 CGGTGGCCCGGGAGGGGCGCCGG - Intronic
903384472 1:22917363-22917385 CAGGGGCCCTGGAGTGAGCCAGG - Intergenic
903446675 1:23426758-23426780 CAGTGGCCGTTGAGGGGAGGAGG + Intergenic
904002733 1:27348040-27348062 CAGTGTCCCTGGAGGGGAGGTGG + Intronic
904034618 1:27551983-27552005 CAGGGGGCCGGGTGGGAAGCAGG + Exonic
904206966 1:28861770-28861792 CAGGCTCCCTAGAGGGAAGCAGG - Intronic
904268040 1:29329110-29329132 CAGAGGCCCTGGACAGAACCCGG - Intergenic
904457550 1:30656734-30656756 CAGTGGCCTTTGGGGGCAGCTGG + Intergenic
905488746 1:38327213-38327235 CTGAGGCCTTGGAGGCAAGCAGG + Intergenic
905688448 1:39925703-39925725 AAGTGGCCCTGGAGAGCAGGAGG - Intergenic
905696793 1:39980614-39980636 CAGCTGCCCTGGAGGGAAAAAGG - Intergenic
905731659 1:40302802-40302824 CAGTTGCTCTGGAGGGAGGGAGG + Exonic
906706189 1:47896497-47896519 CAGAGACCCTGGTGGGAAGTGGG + Intronic
907110628 1:51923328-51923350 CAGAGGCCATGCAGGGATGCAGG + Intronic
907268316 1:53276021-53276043 GAGTGGCCCTGGAGAGAGGCAGG - Intronic
908923515 1:69224944-69224966 AACAGGCCCTGGAGGTAAGCAGG + Intergenic
909659290 1:78064380-78064402 CACTGGCATTTGAGGGAAGCAGG - Intronic
911321737 1:96421803-96421825 CAGTGCCCCACGAGGGAAGGAGG - Intergenic
914917594 1:151827988-151828010 CAGGGCCCCGGGAGGAAAGCGGG - Intronic
915125198 1:153658884-153658906 CAGGTGCCCGGGAGGGAAGTTGG + Exonic
916173357 1:162018624-162018646 CAGAGGCCCTGGCAGGAAGGTGG + Intronic
916186898 1:162142237-162142259 CAGTGGCTCTGTAAGGAAGATGG + Intronic
917032932 1:170714764-170714786 AAGTTGCCCTAGAGGGAAGGTGG - Intronic
918789938 1:188813088-188813110 GAGAGGCACGGGAGGGAAGCAGG + Intergenic
919729079 1:200901494-200901516 CTGTGGGCCTGGAGGGCAGCGGG - Intronic
919841024 1:201609494-201609516 CAGTGGCCCTGGAAGTATGTGGG + Intergenic
920215396 1:204358928-204358950 CAGTGGAAGGGGAGGGAAGCGGG - Intronic
920572041 1:207024709-207024731 CCTTGTCCCTGGAGGGAAGGAGG - Intronic
920702924 1:208231331-208231353 GAGGGACCCAGGAGGGAAGCGGG + Intronic
922314952 1:224434396-224434418 GAGAGGCCGTGGTGGGAAGCCGG + Intronic
922773536 1:228203779-228203801 CAGAGGCTGGGGAGGGAAGCGGG + Exonic
924825201 1:247531560-247531582 CTGTGGCTCTGCAGGCAAGCTGG - Exonic
1062763457 10:44925-44947 CAGGGGCCCAGGAGGGAACAGGG - Intergenic
1062804314 10:405809-405831 GAGGAGCCCTGGAGGGGAGCTGG - Intronic
1063103255 10:2969990-2970012 CAGTGGCTCTTGAGGAAAACAGG + Intergenic
1064274546 10:13893886-13893908 CAGTGGCCAAGGCGGAAAGCAGG - Intronic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1067054822 10:43044412-43044434 CAGGGGCCCTGGCAGCAAGCAGG - Intergenic
1067411737 10:46070644-46070666 CAGTGGTGCTGAAAGGAAGCAGG + Intergenic
1067463030 10:46472131-46472153 GAGTGGCCATGCAGGGAGGCAGG + Intergenic
1067624164 10:47912507-47912529 GAGTGGCCATGCAGGGAGGCAGG - Intergenic
1067784158 10:49230266-49230288 CAGGGGCCCGGGAGGAAAGATGG + Intergenic
1068431206 10:56934750-56934772 CAGTGGCCCAGTGGGGACGCTGG - Intergenic
1068963194 10:62886115-62886137 CAGTGAGTCAGGAGGGAAGCTGG + Intronic
1069528978 10:69201197-69201219 GAGGTGCCCAGGAGGGAAGCAGG - Intronic
1069889979 10:71646625-71646647 CAGTGGCCCTGCAGTGAAGCGGG - Intronic
1069911788 10:71764580-71764602 CAGTTGCCCTGTGGGAAAGCTGG - Intronic
1070191944 10:74119009-74119031 GAGTGGCCCTGCTGGGAAGATGG - Exonic
1070961392 10:80502467-80502489 CAGAGACACTGGAGGAAAGCTGG + Intronic
1071449171 10:85778165-85778187 CACTGGCCCTGGAGGGGCTCTGG + Intronic
1071525851 10:86357834-86357856 CAGTAGCCCTTGAGGGGACCAGG + Intronic
1072695394 10:97599571-97599593 AGGTGGCCCTGTAGTGAAGCAGG + Intronic
1072764213 10:98082842-98082864 CAGGGGACATGGGGGGAAGCTGG + Intergenic
1072822009 10:98567538-98567560 AAGCTGGCCTGGAGGGAAGCAGG + Intronic
1074183186 10:111080306-111080328 CAGTGGCCCTGGAGGGAGAGAGG - Exonic
1074533991 10:114315666-114315688 CAGTGGCCCTCGCCGGAGGCCGG - Exonic
1075180513 10:120206936-120206958 CAGTGGAGCTGGAGGGAAGGAGG - Intergenic
1075329166 10:121560293-121560315 CAGTGGCTCTGGCATGAAGCTGG - Intronic
1076121793 10:127942117-127942139 CACTTGCCATGGAAGGAAGCTGG + Intronic
1076550990 10:131278080-131278102 CAGTGGGCCCGGGGGGAGGCAGG - Intronic
1076571896 10:131438644-131438666 CAGTGCCCCTGGACAGAGGCTGG + Intergenic
1076740417 10:132480158-132480180 CAGTGGCCCAGGGCGGAAGAGGG + Intergenic
1076794387 10:132791563-132791585 CAGTGGAGCTGGGGGGAAGAGGG + Intergenic
1076836325 10:133022898-133022920 CAGTGGGGCGGGAGGGAGGCAGG - Intergenic
1077055000 11:587188-587210 CCGCGGCACTGGAGGCAAGCGGG - Intronic
1077362197 11:2145684-2145706 TAGTGGCCCTGTAGGGAGGGAGG + Intronic
1077485538 11:2836844-2836866 CAGGGGCCCTAGAGGGAAATGGG + Intronic
1077506125 11:2930713-2930735 CAGTGACCCTGAAGGGCAGGTGG - Intergenic
1077538146 11:3134254-3134276 CAGGGCCCCTGGAGGAGAGCAGG - Intronic
1077828325 11:5835063-5835085 CAGTGGGGCTGGAGGAAAGAGGG - Intronic
1078068578 11:8093921-8093943 CAGGGGCCCTGGTGGGACTCGGG + Intronic
1078270352 11:9789053-9789075 CAGGGGCCCTGGAGGCATGAGGG - Intronic
1078443603 11:11387413-11387435 CAGTTGCCCAGGAGGGGAGTGGG + Intronic
1078596595 11:12692603-12692625 CAGTGCCCACGGAGGAAAGCGGG - Intronic
1079250016 11:18780448-18780470 CAGGGGCCCTGATGAGAAGCTGG - Intronic
1080105268 11:28505078-28505100 GACTGGACCTGGTGGGAAGCTGG + Intergenic
1080715050 11:34792199-34792221 CAGAGGTCCTGGAGTGAAGGAGG - Intergenic
1081837267 11:46166192-46166214 CAGAGGCCCTTGAGGACAGCAGG + Intergenic
1083261876 11:61527587-61527609 CAGAGGCCGAGGAGGGAAGCTGG - Intronic
1083776636 11:64897373-64897395 CAGGGACCCTGGAGAGAGGCTGG + Intronic
1084334020 11:68446545-68446567 CAATGGCCATGGAGGGCTGCAGG - Intronic
1084522768 11:69674759-69674781 CAGGGGCTCTGGAGGGAAAAGGG + Intronic
1084597993 11:70128611-70128633 CAGGCGACCTGGAGCGAAGCGGG + Intronic
1084604521 11:70164836-70164858 CAGTGGCCCTGGAAAAAAGGAGG + Intronic
1084671933 11:70612070-70612092 CACAGGCCCAGGAGGGGAGCTGG + Intronic
1084933880 11:72576759-72576781 GAGGGGCCCTGGGGAGAAGCAGG - Exonic
1084965077 11:72740218-72740240 CAGTGGACCTGGTGGGAGGCAGG + Intronic
1085021491 11:73213008-73213030 CTGTGGGCATGGAGGAAAGCTGG + Intergenic
1085027480 11:73244992-73245014 GAGTGGGCCTGGAGGGGAGGAGG + Intergenic
1085521266 11:77140262-77140284 CAAGGGCCCTGAAGGCAAGCTGG - Intronic
1085741642 11:79082467-79082489 CTGAGGCCGTGGAAGGAAGCAGG - Intronic
1085759794 11:79232246-79232268 AAGGGGCCCTGAAGTGAAGCTGG + Intronic
1087116231 11:94528081-94528103 CAGTGGCCCTGGAAGGGATTTGG + Intergenic
1087169201 11:95033245-95033267 CATTGGCCCTGGAGTGCAGTAGG + Intergenic
1087681693 11:101225070-101225092 CAGTGGCACTGGAGAGTGGCGGG + Intergenic
1089255705 11:117192805-117192827 ATGCGGTCCTGGAGGGAAGCAGG - Exonic
1089278417 11:117355501-117355523 CACTGGCCCTGGAGGGGACAAGG + Intronic
1089383440 11:118052368-118052390 CTGGGGCCCTGCAGGGAAGCAGG + Intergenic
1089567415 11:119379014-119379036 CAGGGGCACTGGATGGGAGCTGG + Intronic
1090208518 11:124898987-124899009 TAGGGGCCCTGCAGAGAAGCTGG - Intergenic
1090217635 11:124984003-124984025 CAGTGGCCGTGCAGGGCAGGGGG + Intronic
1090636376 11:128692881-128692903 CGGCGGCCCAGGAGGGAGGCGGG + Intronic
1090965016 11:131590933-131590955 CAGTGGCCCTGAAGTGAGGTGGG + Intronic
1091041409 11:132284763-132284785 CAGTGGCCTTGGGGAGAAGGCGG + Intronic
1091161847 11:133429951-133429973 CAGTGAGTCTGGATGGAAGCGGG + Intronic
1091235180 11:134017156-134017178 GAGTGGCACTGCAGGGAGGCAGG + Intergenic
1091280777 11:134380397-134380419 CACTGGCCCTGCAGTGATGCAGG - Intronic
1091300480 11:134504065-134504087 GAGTGGGCTTGGAGGGATGCTGG + Intergenic
1091402278 12:188434-188456 GAGAGGCGCTGGCGGGAAGCGGG - Intergenic
1092905064 12:13093556-13093578 CTGTGGCAGTGGATGGAAGCTGG - Intronic
1093034215 12:14317877-14317899 CAGTGGCTCTGGAGGGAGCATGG - Intergenic
1094490994 12:30960514-30960536 CAGCAGACCTGGAGGAAAGCAGG - Intronic
1094573404 12:31662050-31662072 CAGTGTCCCTGGAGAGGAGCTGG + Exonic
1096472657 12:51889020-51889042 GAGTGGCCCAGGGGGAAAGCAGG + Intronic
1096816893 12:54207469-54207491 CAGTGGAGGTGGGGGGAAGCAGG + Intergenic
1098014803 12:66092846-66092868 CAGTGGGTCTGGAGCCAAGCAGG - Intergenic
1101376001 12:104172209-104172231 CAGTGCTCCTGGAGGGGAGCAGG + Intergenic
1101992415 12:109497910-109497932 CAGTGACCCCTGAGGTAAGCAGG + Exonic
1103436217 12:120929062-120929084 GACAGGCCCTGGAGGGAAGTGGG - Intergenic
1103447694 12:121004875-121004897 CAGTGGCCCTGTCAGGCAGCTGG - Intronic
1103477877 12:121232111-121232133 CAGGGTCCCTTGAGGGAGGCAGG + Intronic
1104478167 12:129087583-129087605 CAGAGGCCCAGGAAGGAAGGAGG + Intronic
1104603407 12:130169137-130169159 CAGTGGGGCTAGGGGGAAGCAGG + Intergenic
1104818368 12:131661430-131661452 CTGTTTCCCTGGAGGGCAGCTGG + Intergenic
1104830831 12:131750111-131750133 CTGTGGCCCTGGTGGGAGGCAGG - Intronic
1104903722 12:132202723-132202745 CAGTGGCCAGGGAAGGAAGGGGG + Intronic
1105290762 13:19051530-19051552 CTGTGGCCCTGGCGGGAGACTGG + Intergenic
1107181872 13:37471150-37471172 CACTGTCCCAGGAGGGAAACTGG + Intergenic
1107821378 13:44288769-44288791 CAGGGACCCTAGGGGGAAGCCGG - Intergenic
1108326410 13:49336708-49336730 TAGTGGCCCTGGAAGGAAGATGG - Intronic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1111991034 13:95117411-95117433 CAGTGGCCCTGGGGAGGAGCTGG + Intronic
1112088433 13:96054908-96054930 CCTTTGCCCTGCAGGGAAGCTGG + Intergenic
1112164582 13:96904497-96904519 CAGTAGCTCTGCAGGGAAGAGGG + Intergenic
1113565962 13:111320073-111320095 CAGAGGTCCTGGGGGGAGGCTGG - Intronic
1113595241 13:111527053-111527075 CAGTGGGCCTGGACAGAAACCGG + Intergenic
1113615993 13:111681061-111681083 CAGTGGCCCCGGAGGGCATTTGG + Intergenic
1113621461 13:111765954-111765976 CAGTGGCCCCGGAGGGCATTTGG + Intergenic
1113781638 13:112980777-112980799 CAGTGGACTCGGAGGGAGGCTGG - Intronic
1114695937 14:24627845-24627867 CTGTGGCCCTGGAGGAAAAGAGG + Intergenic
1118039812 14:61904354-61904376 CCGAGGCCCTGAAAGGAAGCTGG - Intergenic
1119399005 14:74349273-74349295 CGGTGGCCCTGGAGGCCAGCTGG - Intronic
1120160718 14:81142049-81142071 CAGTCGCCTTGGTGGGAACCTGG - Intronic
1121221391 14:92288235-92288257 AAGTGGCCAGGGAGGCAAGCTGG - Intergenic
1122821193 14:104346008-104346030 AAGAGGGCCTGGAGGGAAGGAGG - Intergenic
1122907237 14:104807503-104807525 CAATGGCCCCAGAGGGAGGCAGG - Intergenic
1123787934 15:23690923-23690945 CAGTGGCCCCCTAGGGAGGCTGG - Intergenic
1123907271 15:24933314-24933336 CTGTGGCTCTGGAGGGCGGCTGG + Intronic
1123931130 15:25172145-25172167 CAGGGGTCCTGCAGGGGAGCTGG + Intergenic
1124241133 15:28028484-28028506 CAGTGGAGCTGTAGGGAAGGTGG + Intronic
1124345157 15:28917343-28917365 AAGGAGCCCTGGAGGGGAGCAGG - Intronic
1125329186 15:38565210-38565232 GAGAGGCCCTGGAGGGGAGAAGG - Intronic
1125972375 15:43922191-43922213 CACTGGCCCTGGAGTCAAACAGG + Intronic
1125979367 15:43985951-43985973 CAGTGGGCCTGAAGGAATGCAGG + Intronic
1127815896 15:62608622-62608644 CAGCGACACAGGAGGGAAGCAGG + Intronic
1127832769 15:62765392-62765414 CTGTGGGCCGGGAGGGATGCGGG - Intronic
1128710116 15:69865500-69865522 CAGGGGCCCAGAAGAGAAGCCGG + Intergenic
1129521737 15:76190542-76190564 CAGTGGAGGTGGAGGGAGGCGGG + Intronic
1129712553 15:77827889-77827911 CAGAGGCCCTGGAATGAGGCAGG + Intergenic
1129850468 15:78790880-78790902 CAGAGGCCCAGCAGGGAAGTGGG + Intronic
1130042836 15:80419281-80419303 CAGTGGACCTGAAGGGGATCTGG - Intronic
1130403459 15:83578272-83578294 CAGGGGCTCCGGAGGGAGGCAGG - Intronic
1131050759 15:89346345-89346367 TAGAGGCCCTGGAGGGAGTCAGG + Intergenic
1131384631 15:91993835-91993857 CGCTTGCTCTGGAGGGAAGCTGG + Intronic
1131452887 15:92560888-92560910 CTGTGGACCTGGAGGCAGGCAGG + Intergenic
1132603098 16:782608-782630 CTGTGGCCCAGGAGGGAGACAGG + Intronic
1132624139 16:882134-882156 CAGTTGCCTTGGTGGGAAGTGGG - Intronic
1132782702 16:1636850-1636872 CAGTGGCTCTTGAGGAAAGAGGG + Intronic
1132892635 16:2211773-2211795 AAAGGGCCCTGGAGTGAAGCTGG - Exonic
1132943095 16:2518181-2518203 TGGTGGCCCTGGAGGGCAGCTGG + Intronic
1133221492 16:4320900-4320922 CAGTGGCCCTAGAACCAAGCAGG - Intronic
1133235049 16:4383874-4383896 CCCTGTCCCTGGAGGAAAGCAGG - Intronic
1133252551 16:4493061-4493083 CTGTGGCCCAGGCTGGAAGCTGG + Intronic
1133923965 16:10179845-10179867 CACTGGCCCTGGTGAGAACCAGG - Intronic
1134012987 16:10868920-10868942 TGGCAGCCCTGGAGGGAAGCTGG - Intergenic
1134566108 16:15253216-15253238 CAGTGGGACAGGATGGAAGCTGG + Intergenic
1134736386 16:16503482-16503504 CAGTGGGACAGGATGGAAGCTGG - Intergenic
1134931129 16:18208686-18208708 CAGTGGGACAGGATGGAAGCTGG + Intergenic
1135327076 16:21533287-21533309 CACTTGCTCTGGGGGGAAGCTGG + Intergenic
1135568205 16:23528338-23528360 CAATGGCACTGCAGGGAAGCAGG + Intronic
1136337392 16:29619127-29619149 CACTTGCTCTGGGGGGAAGCTGG + Intergenic
1137674920 16:50299464-50299486 CAGGGGACCTAGAGGGGAGCGGG - Intronic
1138104106 16:54278026-54278048 CAAAGGCCCTGGAGGGCTGCGGG + Intergenic
1138116056 16:54361624-54361646 CAGTGGCACTGAAGGGGAGGAGG + Intergenic
1138271862 16:55701460-55701482 CTCTGGCCCTGCAGGGAATCAGG - Intronic
1138573695 16:57892735-57892757 CAGAGGCCCTGGGGAGGAGCAGG - Intronic
1139967251 16:70752635-70752657 GCGGGGCCCTGGAGGGAGGCAGG - Intronic
1140893133 16:79302071-79302093 TAGTGGCACTGGAGGGATGCAGG - Intergenic
1141494137 16:84395274-84395296 CAGTGACACTGGAGGGGAGAGGG - Intronic
1141745617 16:85924129-85924151 TCTGGGCCCTGGAGGGAAGCTGG + Intergenic
1141852029 16:86652990-86653012 CAGAGGGTCTGGAGGGAAGAAGG - Intergenic
1141859937 16:86709670-86709692 CAGTGAAGCTGGAGAGAAGCAGG + Intergenic
1142040193 16:87888471-87888493 CACTTGCTCTGGGGGGAAGCTGG + Intronic
1142229979 16:88895565-88895587 CAGTGGCACAGGGGGGAGGCCGG + Intronic
1142502335 17:340060-340082 CAGTGGGTCTGGTGGGGAGCAGG - Intronic
1142964694 17:3573286-3573308 GGGTGGTCCTGGAGGGAAGAAGG - Intronic
1143864979 17:9917123-9917145 CAGTGGCCCAGGAGAGAGGGTGG + Exonic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144190183 17:12838556-12838578 CGGTGGCAGTGGAGGGAATCAGG + Intronic
1144653430 17:17020947-17020969 CTGTGGCCCTGCAGGGCACCCGG - Intergenic
1144670935 17:17132220-17132242 CACTGGCCAGGGAGGGAAGGAGG - Intronic
1144753827 17:17667829-17667851 CACAGGCCCTGGAGGGCAGCAGG + Intergenic
1144847447 17:18227257-18227279 GAGGGGCCCAGAAGGGAAGCTGG + Intronic
1148737813 17:49874632-49874654 CAGGGGCCATGGTGGGAAGGGGG - Intergenic
1148868904 17:50643977-50643999 CAGGGGCACTGGAGGGCAGAGGG + Intronic
1149595323 17:57861808-57861830 CTGGGGCCCTGGAGGGAGGGGGG - Exonic
1150130468 17:62666299-62666321 CAGTGTTCCTGGAGGGAGGCTGG + Intronic
1150250909 17:63704040-63704062 CACTGGGCCTGGAGGGAAAGGGG + Exonic
1151820264 17:76493228-76493250 CTGTGGCCCTGCTGGGAACCAGG + Intronic
1152098431 17:78286686-78286708 CAGCAGCCCTGGAGAGAAGGAGG + Intergenic
1152154794 17:78625927-78625949 CAGTGGCCATGCAGAGAAGCAGG + Intergenic
1152196985 17:78924152-78924174 CAGGCGCCATGGAGGGAGGCAGG - Intronic
1152723045 17:81932123-81932145 CACTGCCTCTGGAGGGAAGGGGG + Intergenic
1152740309 17:82015799-82015821 GAGTGGCCCTGGAGAGGCGCCGG - Intronic
1152877563 17:82795808-82795830 CAGGGGCCCTTGACTGAAGCTGG + Intronic
1152956366 18:45256-45278 CAGGGGCCCAGGAGGGAACAGGG - Intergenic
1154112180 18:11579538-11579560 CAGTGGACGTGGAGTGAGGCTGG - Intergenic
1154172835 18:12063492-12063514 CACTGGTCCTGGAGGGATCCTGG - Intergenic
1156476846 18:37410865-37410887 CAGTGCCCCTGCAGGGCAGCTGG - Intronic
1157302463 18:46488934-46488956 CATTGGCTCAGGAGGGAGGCAGG - Intronic
1157451791 18:47794483-47794505 CAGTGCCCCTGGAGCGAGGGGGG + Intergenic
1157966949 18:52218962-52218984 GAGTGACCATGCAGGGAAGCTGG - Intergenic
1158551810 18:58442560-58442582 CAGTGGGGCTGGAAGGAAGCTGG - Intergenic
1158706356 18:59795842-59795864 CTGTGGGCCTGGAGGGTAACTGG + Intergenic
1158920686 18:62187741-62187763 CAGTGGCCCTGGGGGGCACCGGG + Exonic
1159025526 18:63179402-63179424 CAGGGGCCCTAGAGGGACTCAGG - Intronic
1159404055 18:67977208-67977230 CACACGCACTGGAGGGAAGCGGG + Intergenic
1160040376 18:75339732-75339754 CAGTGGCCCTGGAGGTCTCCAGG + Intergenic
1160667691 19:340735-340757 CACTGGCCCTGGAGTGACTCTGG + Intronic
1160799366 19:960660-960682 CTGAGGCCCTGGTGGGAAGAGGG - Intronic
1161226682 19:3150206-3150228 CAGTGGCTGTGGAGGGATGCCGG + Exonic
1161234137 19:3189731-3189753 CCCTGGCCCTCGAGGGAGGCTGG + Intronic
1161241144 19:3224641-3224663 CGGGGGCCCGGGAGGGAGGCGGG + Intergenic
1162017389 19:7852995-7853017 CTGTTGCCCTGGAGGGGGGCAGG - Intronic
1162146019 19:8612352-8612374 GAGAGGCCCTGGTGGGAAGGAGG - Intergenic
1162463926 19:10829789-10829811 CTGAGGCCCAGGAGGGAATCTGG + Intronic
1162800012 19:13105074-13105096 CAGGTGCCCTGGTGGGAAGATGG + Exonic
1163329500 19:16627745-16627767 CAGCGGCCCTCGAGGGGAGGTGG + Intronic
1163460836 19:17436596-17436618 CTGCAGCCCTGGAGGGAGGCTGG - Exonic
1163530930 19:17848366-17848388 GATTTGCCCAGGAGGGAAGCAGG + Intergenic
1163688106 19:18723771-18723793 CAGTTGCCCTGCAGGGACACTGG + Intronic
1164597157 19:29537794-29537816 CAGTGGCCCTTCTGGCAAGCTGG - Intronic
1165388406 19:35524998-35525020 CAGTCACCCTGGAGGGGACCAGG - Intronic
1165435449 19:35792491-35792513 CAGTGGCCCTGGTGGGAGTGAGG - Intergenic
1165843219 19:38801949-38801971 CTGAGGCCCTGGAAGGAAGTGGG + Intronic
1166081747 19:40447997-40448019 CAGTGACCCTGGATGGACGAGGG - Exonic
1166995089 19:46716361-46716383 CGGTGGCCATGGGGGGAGGCCGG + Exonic
1168456331 19:56511716-56511738 CAGTGGCCCCTGAGAGAAGTGGG - Intronic
1168588434 19:57613707-57613729 CAGTGGCTATGGAGGGATGCTGG - Intergenic
925686279 2:6476824-6476846 CAGTGGCCCTGGAGAAAGACAGG + Intergenic
925820979 2:7799624-7799646 CAGGGGCCATGCAGGGCAGCTGG - Intergenic
926588643 2:14716632-14716654 CCATGGTCCTGGAGGGCAGCAGG + Intergenic
927149242 2:20186257-20186279 CAGGGTCCCTGGAGGGAGCCGGG + Intergenic
927672247 2:25078578-25078600 CAGCAGGGCTGGAGGGAAGCTGG - Intronic
927680366 2:25135185-25135207 GATGAGCCCTGGAGGGAAGCGGG - Intronic
927783090 2:25954890-25954912 CAGTGGCTTTGGAGAGGAGCAGG - Intronic
928069709 2:28202374-28202396 CAGGGGCATGGGAGGGAAGCAGG - Intronic
929049764 2:37826173-37826195 CAGTGACCCTGGGGGGAGGGTGG + Intergenic
929149316 2:38733489-38733511 CAGCAGCACAGGAGGGAAGCGGG - Exonic
929191773 2:39146925-39146947 CAGTGGGACTGGGGGAAAGCAGG - Intergenic
930246791 2:48991644-48991666 CAGTTGCACTTGAGTGAAGCTGG + Intronic
931557298 2:63519245-63519267 CAGTGGCTCTGCAGGGCAGAGGG - Intronic
932280377 2:70486251-70486273 CAGTGGCCCTTAAGGGACGAAGG + Intronic
932575517 2:72960423-72960445 CAGTGGGCATGGAGAGAAGTGGG - Intronic
932795504 2:74692018-74692040 CACTGGGCCAGGAGGGAAGCTGG + Intergenic
933315942 2:80715205-80715227 CAGTGGCATTTGAGGAAAGCAGG + Intergenic
933362264 2:81303160-81303182 CAGTGGGCCTGGAGGAAAGCAGG - Intergenic
933650581 2:84846996-84847018 AGGCTGCCCTGGAGGGAAGCTGG + Intronic
934954455 2:98605934-98605956 CAGTGGGGCTGGAGGAAAGCAGG - Intronic
935065188 2:99641206-99641228 CAGTGTCACTGGAGGGACACAGG - Intronic
936327958 2:111521965-111521987 ACGAGACCCTGGAGGGAAGCTGG + Intergenic
936391421 2:112078054-112078076 CATGGCCCTTGGAGGGAAGCTGG + Intronic
937862213 2:126720085-126720107 CTGTGGGCCTTGAGGGAAGTGGG + Intergenic
938256235 2:129861910-129861932 CAGCTACCCTGGTGGGAAGCTGG - Intergenic
938686427 2:133742417-133742439 CAGAGGCCCTGGAGGAAAAAGGG - Intergenic
938786791 2:134637183-134637205 CAGTGGCCCTGGTGGGGAATTGG - Intronic
939408663 2:141795411-141795433 CAGCAGCCCTTGAGGGAAGATGG + Intronic
942181937 2:173388496-173388518 CAGAGGGTCTGGAAGGAAGCAGG + Intergenic
942342582 2:174963600-174963622 CTCAGGCCCTGGAGGGAACCTGG + Intronic
942444530 2:176069200-176069222 CAGGGGCCCTGGGAGGAAGGTGG + Intergenic
942944411 2:181657128-181657150 CAGGGACCCAGGAGGGAGGCGGG + Intronic
943088751 2:183349221-183349243 CAGAGAGCCTGGAGGGAAGCGGG - Intergenic
943657968 2:190529323-190529345 CAGTGGGCTGGGAGGGAAGGTGG - Intronic
944621756 2:201522914-201522936 GAGTGGCCAAGTAGGGAAGCTGG - Intronic
944665272 2:201954233-201954255 CAGCTGCCCTGAAGGAAAGCTGG + Intergenic
945285494 2:208077823-208077845 CAGGGGCCCTTGTGGGGAGCGGG + Intergenic
946048768 2:216843289-216843311 CAGGGGGCCTGGAAGGAAGGGGG + Intergenic
946223573 2:218249684-218249706 CCCAGGCCCTGCAGGGAAGCAGG - Intronic
946349391 2:219139408-219139430 CACTGGCTCTGGAGGAAACCAGG + Intronic
948053516 2:234995222-234995244 AAGGGGCCCTGGCGGGAAGCAGG + Intronic
948610232 2:239162113-239162135 CAGTGGGGCTGCTGGGAAGCAGG - Intronic
1171101261 20:22385493-22385515 CAGAGCCCCTGGAGGGAGCCTGG + Intergenic
1172442832 20:34977981-34978003 CAGTGGCACTGGGGTGAAGGAGG - Exonic
1172621633 20:36321381-36321403 CATGGGCCCTGGAGGGCTGCGGG + Intronic
1172703380 20:36865546-36865568 CAGTGGGCCGTGAGGGGAGCTGG - Intergenic
1172826281 20:37789582-37789604 CATTGTCCCTGGAGGGAGACTGG + Intronic
1173748827 20:45459841-45459863 CAGTGGCCCAGCAGGGGAGACGG - Intergenic
1174575803 20:51536283-51536305 ATGTGGCCCTGGAGGGCAGCAGG - Intronic
1175164455 20:57033403-57033425 CAGTGGGGCTGGAGAGAAGGGGG + Intergenic
1175340266 20:58224526-58224548 CAGTGGCCCTGGAGGGAAGCAGG - Intronic
1175802323 20:61807886-61807908 CTGTGGGCCTGGCGGGATGCAGG + Intronic
1176023308 20:62973487-62973509 CAGTGGGCTTGGGGAGAAGCCGG - Intergenic
1176037213 20:63045403-63045425 CAGTGGCCCTGGTGGGGATTCGG + Intergenic
1176117028 20:63437241-63437263 GAGTGACCTTCGAGGGAAGCAGG + Intronic
1176131126 20:63497279-63497301 CCTTGGCCCTGGGGGGAAGGGGG + Intronic
1176215632 20:63946386-63946408 CACAGGCACTGGAGGGGAGCCGG + Intronic
1176375171 21:6083418-6083440 CAGTGGCCCTTGTGGAAAGGGGG + Intergenic
1178293356 21:31387773-31387795 AGGTGGGCCTGGAGGGAAGCCGG + Intronic
1178666209 21:34549218-34549240 CAGTGGCCCTCGAAGGCACCAGG + Intronic
1179032628 21:37733956-37733978 AAATGGCCCTGGATTGAAGCAGG + Intronic
1179585182 21:42370152-42370174 AGGTGGCCCTGGAGGGAGGGAGG + Intergenic
1179615586 21:42581084-42581106 CCATGGCCCCGGAGGGCAGCAGG - Exonic
1179712669 21:43272360-43272382 CAGTGAGCCTGGAGGGAGGCAGG + Intergenic
1179748303 21:43454826-43454848 CAGTGGCCCTTGTGGAAAGGGGG - Intergenic
1179999685 21:44989755-44989777 CAGCGGCTCTGGAGGGCATCGGG - Intergenic
1180106649 21:45623109-45623131 CACGGGCCCAGGAGGGGAGCGGG - Intergenic
1180160704 21:45997637-45997659 TGGTGACCTTGGAGGGAAGCAGG - Intronic
1180994611 22:19959441-19959463 CACTGGGCCGGGAGGGACGCGGG - Intronic
1181101133 22:20540078-20540100 CAGTGGAAGTGGAGGGATGCAGG + Intronic
1181437960 22:22921294-22921316 CAGTGGCCCTGTCATGAAGCAGG - Intergenic
1182413590 22:30206848-30206870 CAGTGGCCCTGGTGGAAGCCTGG - Intergenic
1183539698 22:38422958-38422980 CCCTGGCTCTGCAGGGAAGCTGG + Intergenic
1184029211 22:41881625-41881647 CAGTGGTCCTAGAGGGAGCCAGG + Intronic
1184194557 22:42918152-42918174 CAGTGGCCCTGGTGTGCAGCTGG - Intronic
1184254018 22:43276860-43276882 ATGCTGCCCTGGAGGGAAGCTGG - Intronic
1184333701 22:43841178-43841200 CAGGGGCCCTGGAGGGCCACAGG + Intronic
1184480538 22:44744344-44744366 CAGTGGGCCTGATGGGAAACCGG + Intronic
1184629032 22:45761351-45761373 CAGGGGCCCTGGAGAGAATGAGG - Intronic
1184675011 22:46036783-46036805 CAGAGGCCCTGGAGGGCAAAGGG + Intergenic
1184730102 22:46367111-46367133 AAGGGGCCCTGGAGGGAGGAAGG + Exonic
1184733677 22:46385463-46385485 CAGTGAGCCTGGAGTGAGGCGGG + Intronic
1184855534 22:47144494-47144516 CAGGGGCCAAGGAGGGACGCTGG - Intronic
1184969215 22:48003221-48003243 CAGGGGACCTGGAAGGAAGGTGG + Intergenic
1185058250 22:48592257-48592279 CAGTGGCCCTGGAGTGAGGCTGG + Intronic
1185070643 22:48654004-48654026 CGGCGGCTCTGGAGGGAAGGGGG + Intronic
1185070667 22:48654111-48654133 CCGCGGCTCTGGAGGGAAGAGGG + Intronic
1185222398 22:49635773-49635795 CAGAAGCCATGGAGGTAAGCCGG - Intronic
1185400513 22:50613179-50613201 AAGTGCCCCTGGAGGTCAGCTGG - Intronic
949890952 3:8733453-8733475 CACTGCCCGTGGAGGGAAGTGGG - Intronic
950452638 3:13073749-13073771 CTCTGGCCCTGGAGTGAGGCCGG + Intergenic
951253751 3:20425277-20425299 CAGTTTCCCTGGAGAGAAGGAGG + Intergenic
951606617 3:24441668-24441690 CAGTGGTCGTGTAGGCAAGCGGG - Intronic
952951888 3:38532388-38532410 CAGTCACCCTGGTGGGAAGATGG + Intronic
953583496 3:44178352-44178374 CATTGGCCCTGGAGGGCTGGGGG + Intergenic
953912230 3:46898947-46898969 CAGTGGCGCTGGCAGGAGGCGGG - Intronic
954093202 3:48301490-48301512 GAGTTGCCCTGGAGGGTGGCGGG + Intronic
954109070 3:48424276-48424298 CAGGGGCCCTGGTGGTATGCGGG - Exonic
954217560 3:49132969-49132991 CAGAGGGCCTGGAGGGAAACAGG - Exonic
956590383 3:70908333-70908355 CAGTTGACCTGGATGGAAGTGGG + Intergenic
959833999 3:110896977-110896999 AAGTGGACCTGCAGGGGAGCCGG - Intergenic
961122458 3:124384592-124384614 CAGTGTCCCTGGAAAGAAGTGGG - Intronic
961328432 3:126125209-126125231 CAGAAGTCCTGGAGAGAAGCAGG - Intronic
961357661 3:126349290-126349312 CAGGGGACCTTGGGGGAAGCTGG + Intronic
961522618 3:127475680-127475702 CTTTGTCCTTGGAGGGAAGCTGG + Intergenic
962271108 3:133978701-133978723 GAGTGGCCCTGGGGAGAAGATGG + Intronic
962309256 3:134313709-134313731 CAGTCGCGCTGGAGGAAAGGAGG + Intergenic
962344640 3:134610260-134610282 CTGTGTACCTGGAGGGAAGATGG - Exonic
962958512 3:140288665-140288687 CAGTGGTGTTGGTGGGAAGCAGG - Intronic
963103329 3:141625267-141625289 CAGGGGCCCAGAAGGGAACCTGG + Intergenic
966597539 3:181738020-181738042 CAGTGGCTCTCTAGGGAAGGAGG - Intergenic
966735230 3:183182028-183182050 CGCGGGCCCTGCAGGGAAGCGGG + Intronic
966886900 3:184381851-184381873 CCGGGGCCCGGGAGGGAAACTGG + Intronic
966963471 3:184965836-184965858 CAGTGGCAATGGAGAGAAGAGGG + Intronic
967185831 3:186943853-186943875 CATGGGCTCTGGAGGCAAGCAGG - Intronic
967482596 3:189990989-189991011 CAGTGGCCATTGGTGGAAGCAGG + Intronic
967841743 3:194010449-194010471 CAGTGGCCCTGGAATGATGCTGG - Intergenic
968719859 4:2193734-2193756 CAGTGACCCAGGAGCAAAGCAGG - Intronic
969305578 4:6324573-6324595 GCGGGCCCCTGGAGGGAAGCAGG - Intronic
969392748 4:6901971-6901993 CAGCGGCTCTGGAGGGAGACAGG + Intergenic
969495091 4:7521953-7521975 CTGTGCCACTGAAGGGAAGCCGG - Intronic
973015396 4:45131063-45131085 AAGTGGCAATGAAGGGAAGCTGG - Intergenic
973969989 4:56203885-56203907 CAGTGGCCTTGTATGGAGGCAGG - Intronic
975523363 4:75323832-75323854 GAGTAGCCCAGGAAGGAAGCAGG + Intergenic
983238558 4:165207102-165207124 CAGTGTCCCAGGCAGGAAGCAGG - Intronic
983521371 4:168712399-168712421 CAATGAAACTGGAGGGAAGCAGG + Intronic
984203622 4:176758943-176758965 CACTGGCCCTGGATGGCAGTGGG - Intronic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985712117 5:1435460-1435482 CAGTGGCTCTGGAAGGACCCAGG - Intronic
985800463 5:2002436-2002458 CAGTGGCCCTGGAAGTAGGCAGG - Intergenic
985872606 5:2569349-2569371 CAGGGGCCGTGGCGGGCAGCCGG + Intergenic
986308783 5:6535940-6535962 CAGGGGCCTTGGATGGAGGCAGG - Intergenic
986591426 5:9374838-9374860 CAGTGAGCCTGGAGGGCAGGAGG - Intronic
987119460 5:14753078-14753100 GAGTGGCCCTGGATGGGAGGAGG + Intronic
989412775 5:41139793-41139815 CACTGGCACTGGAGGGAAGAAGG - Intergenic
992507208 5:77398691-77398713 CTGTGGCCCGGAAGGGCAGCAGG - Intronic
993507876 5:88733327-88733349 CAGAGGCTCTGGAGGGATGCAGG + Intronic
996340934 5:122438211-122438233 CAGTGGCCCTGGCTGGGAACTGG - Intronic
996540775 5:124628758-124628780 CAGTGGCCCTGGAAAGCAGGAGG + Intergenic
997211796 5:132081211-132081233 AAGGGGCACTGGTGGGAAGCTGG + Intergenic
997567270 5:134898047-134898069 CAGTGGTGCTGAAGGGAGGCTGG - Intronic
999197445 5:149792075-149792097 GAGTGGCCTGGGAGGGAAGGTGG + Intronic
999657712 5:153826889-153826911 CAATGGCCCTGGAGAAGAGCTGG - Intergenic
1000064714 5:157684566-157684588 CTGTGGCCCTGGAGAGGAGGAGG - Intergenic
1000179500 5:158794250-158794272 CAGTGGCACTGGAGGGACAGAGG + Intronic
1001865886 5:175105057-175105079 CAGTTGCCCTGGAGGCAATAAGG - Intergenic
1001980689 5:176035495-176035517 CTGTGGCCCTGGTGGGGGGCTGG - Intergenic
1002183432 5:177442982-177443004 AGGTGGGCCTGGAGGGAAGCAGG + Intergenic
1002236772 5:177808570-177808592 CTGTGGCCCTGGTGGGGGGCTGG + Intergenic
1002355651 5:178626993-178627015 CAGCGGCCGAGGAGGGAAGACGG - Exonic
1002922792 6:1585104-1585126 CAGGGGCCCCTGGGGGAAGCCGG - Intergenic
1003158583 6:3617015-3617037 GTGTGACCCAGGAGGGAAGCAGG - Intergenic
1003528354 6:6917101-6917123 CTGCTGCCCTGGTGGGAAGCTGG + Intergenic
1003974371 6:11328825-11328847 TAGTGGCCCCAGAGGGGAGCAGG + Intronic
1005486159 6:26301897-26301919 CAGTGGCTGGGGAGAGAAGCAGG - Intergenic
1005711988 6:28511841-28511863 GAGAGGCGCTGGAGGGAACCAGG + Intronic
1005813199 6:29531498-29531520 CAGCAGCCCTGGAGAGCAGCAGG + Intergenic
1006100427 6:31683012-31683034 CCGTGGGCCTTGAGGGAACCGGG + Intronic
1006190089 6:32202236-32202258 CAGTGGCCCGGGAGGAAACTGGG - Exonic
1006508970 6:34511555-34511577 CAGTGGCCCTGGCAGGCACCCGG - Intronic
1007842842 6:44730799-44730821 CAGGGGGGCTGGAGGGAAGTAGG - Intergenic
1008466918 6:51841847-51841869 CAAGGGCCCTGGAGCCAAGCAGG - Intronic
1010887681 6:81263843-81263865 GAGAGGCCTTGCAGGGAAGCAGG + Intergenic
1012063111 6:94512062-94512084 CTGAGCCCCTGGAGGGAAGGGGG + Intergenic
1013793455 6:113859579-113859601 CAGGGGCCTTAGGGGGAAGCGGG + Intronic
1015190662 6:130468233-130468255 CAGAGGGCCTGGAAGGAGGCTGG - Intergenic
1015372327 6:132468094-132468116 CAGAGGCCCTGGAAATAAGCTGG + Intronic
1015612959 6:135045505-135045527 CAGTGGTGCTGGAATGAAGCAGG + Intronic
1015921735 6:138273187-138273209 CATTGGGCCTTGAGAGAAGCGGG + Intronic
1016586022 6:145686981-145687003 CCATGGCCCTGGAAGGAAGATGG - Intronic
1017820605 6:158046385-158046407 CAGGGGGCCGGGAGGGCAGCGGG + Intronic
1018047048 6:159974758-159974780 CAAAGGCCCTGGAGGGGAGGGGG + Intronic
1018443444 6:163834342-163834364 GAGGGGCCCTGGAGTGAGGCTGG - Intergenic
1018840169 6:167510756-167510778 GAGGGGCCCTGGTGGGAAGCAGG - Intergenic
1018875118 6:167815674-167815696 CAGCTGCCCTGGAGGGGCGCTGG - Intergenic
1018882090 6:167894166-167894188 CAGTGGCTGTGGAGGGATGCTGG + Intronic
1019016399 6:168883561-168883583 CAGGGACTCAGGAGGGAAGCTGG + Intergenic
1019278402 7:187937-187959 CAGAGGCCAGGGAGGGGAGCGGG - Intergenic
1019294704 7:267558-267580 GAATTGCCCTGGAGGGCAGCGGG + Intergenic
1019636803 7:2080444-2080466 CAGTGGCCGAGGCGGGGAGCCGG - Intronic
1019668198 7:2263319-2263341 GAGCGGCCCAGGAGGGCAGCGGG + Exonic
1019707886 7:2505070-2505092 CAGAGGCCCTGGGAGGAAGCGGG + Intergenic
1019996532 7:4728089-4728111 CCCTGGCCCTGGATGGCAGCCGG + Intronic
1020140662 7:5609750-5609772 CTGTGGCCCTGGAGGAAATGGGG - Intergenic
1021932464 7:25595370-25595392 CAGAGGCTCAGGAGGGAAGGAGG - Intergenic
1022467174 7:30659823-30659845 CTGTGGCCCTTTAAGGAAGCTGG + Intronic
1022471253 7:30682942-30682964 GAGGAGGCCTGGAGGGAAGCAGG + Intronic
1023863423 7:44228130-44228152 AAGTGGCCCTTGAGGAACGCTGG + Intronic
1024296986 7:47852487-47852509 CCCTGGCCCTGGAGAGGAGCTGG - Intronic
1026015627 7:66668791-66668813 CAGATGCCATGGCGGGAAGCAGG + Intronic
1026120476 7:67532499-67532521 CTGTGGCCCTGAAGGGACGCAGG + Intergenic
1026867474 7:73832456-73832478 CAGGGGCCCTGGGCTGAAGCGGG - Exonic
1026939315 7:74277767-74277789 CAGAGGCCCTGGAGGAAGTCAGG - Intergenic
1026939868 7:74281367-74281389 CAGTGACCCTGCAGGGAGGGTGG + Intergenic
1027400053 7:77798113-77798135 CAGAAGCCCTGGAGCCAAGCAGG + Intronic
1028133375 7:87203024-87203046 CAATGGCCCTGGGAGGAAACTGG + Intronic
1028227053 7:88264955-88264977 GAGTAGCCCTGGAGGGTTGCTGG + Intergenic
1030106980 7:105995835-105995857 CATTGGCCTTGGGGTGAAGCAGG + Intronic
1030378092 7:108777014-108777036 GAGTGGTCCTGGAGACAAGCAGG - Intergenic
1030478523 7:110071296-110071318 CAGTGTCACTGGAGGGAATTTGG - Intergenic
1030820706 7:114087548-114087570 CAGTGGCCCCGGCGGGCAGGCGG + Intronic
1031077233 7:117224795-117224817 CAGTGTCCCTGGAAGGAGACGGG - Intronic
1032841930 7:135721344-135721366 CAGGGGCCCTGCAGGGACCCAGG + Intronic
1033012232 7:137634983-137635005 CCAGGGCCCTGGAGGGAAACAGG + Intronic
1033599281 7:142877202-142877224 CACTGGCCCTGCGGGCAAGCAGG + Exonic
1034324780 7:150220520-150220542 CTGGGACCCCGGAGGGAAGCCGG + Intergenic
1034768411 7:153748711-153748733 CTGGGACCCCGGAGGGAAGCCGG - Intergenic
1034785158 7:153919368-153919390 CAGAGGGCCTGAAGGAAAGCTGG + Intronic
1034978204 7:155459861-155459883 CAGGGGCCCTGCAGAGATGCTGG + Intronic
1035046433 7:155970538-155970560 CAAGAGCCCTGGAGGGAAGACGG - Intergenic
1035253596 7:157612834-157612856 CAGAGGCGCTGGGGTGAAGCGGG + Intronic
1035314301 7:157988642-157988664 CAGGGGGGCTGGAGGGAACCGGG + Intronic
1035850437 8:2914586-2914608 CAGTCGCCTTGGAGGACAGCGGG - Intergenic
1036648314 8:10625744-10625766 CAGAGGGCCTGGCAGGAAGCGGG + Intronic
1037787236 8:21910326-21910348 CAGTTCCCATGAAGGGAAGCTGG - Intronic
1038642654 8:29340148-29340170 CTGTGGCACTGGGGGGAACCGGG + Exonic
1040492975 8:47941984-47942006 GCGTGGGCCTGCAGGGAAGCCGG - Intronic
1040602435 8:48897741-48897763 CAGTGATTCTGGAGGGAGGCAGG - Intergenic
1044053944 8:87544233-87544255 TAGTGTCAGTGGAGGGAAGCTGG - Intronic
1045161372 8:99549753-99549775 CAGCGGGCCTGGAGAGAGGCAGG - Intronic
1045485404 8:102627529-102627551 CAGCTGTCCTGGAGGAAAGCGGG + Intergenic
1046755720 8:117971022-117971044 CAGTGCCCCTGAAGGGAATGGGG - Intronic
1047030921 8:120879833-120879855 CAGTGGACCTGGAGAGAAGTTGG + Intergenic
1048251514 8:132869985-132870007 CAGTGGCCCTGCAGGAAATAGGG - Intronic
1048510179 8:135055004-135055026 CGGTGGGGCTGGGGGGAAGCTGG - Intergenic
1048575247 8:135685032-135685054 CAGTGGCTGTGGAGAGAACCGGG - Intergenic
1049325203 8:142017993-142018015 CAGTAGCCATGGAGGGCAGCTGG - Intergenic
1049570466 8:143368005-143368027 AGGTGGTCCTGGAGGCAAGCTGG + Intergenic
1049606964 8:143534237-143534259 CTCTGGCCTGGGAGGGAAGCAGG + Intronic
1049801368 8:144518950-144518972 CAGTGGCTCTCCAGGGAAGAGGG + Intronic
1050587741 9:7130659-7130681 CTGTTGCCCTGGAGGGGGGCAGG + Intergenic
1053354126 9:37432168-37432190 CACTGGTCCTGCAGGGCAGCAGG - Intronic
1056251308 9:84751125-84751147 GAGTGGCACTGGAAGGGAGCAGG - Intronic
1056580225 9:87884680-87884702 CAGAGGCCCTGGTAGGAAGGAGG - Intronic
1057217283 9:93236108-93236130 CAGCGGCCCTCCAGGGAGGCAGG + Intronic
1058528647 9:105885054-105885076 CAGGGTCCCTGGCAGGAAGCTGG - Intergenic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059777053 9:117486627-117486649 CAATGTCCCTGAGGGGAAGCTGG - Intergenic
1060213224 9:121723160-121723182 CTGTGGCTCTGGAAGGAAGAGGG + Intronic
1060604163 9:124899362-124899384 TAGTGGCCCTGGAGAGAACGCGG - Exonic
1060677445 9:125528315-125528337 CAGTGGCCATCAAGGGAAACAGG - Intronic
1060880174 9:127112469-127112491 CAGAGGCCCAGGAGGCAACCTGG + Intronic
1060995451 9:127872965-127872987 CACTGGCACTGGAGGGAGCCCGG - Intronic
1061168626 9:128939161-128939183 CAGTTGCCCGGGAAGGAAGGAGG + Intronic
1061288468 9:129637567-129637589 GAGTGCCGCTGGAGGGAAGGGGG + Exonic
1061497122 9:130981516-130981538 CTGTGGCCCTGAGGGGAAGTGGG - Intergenic
1062000658 9:134214173-134214195 CCAGGGCCCTGGAGGGAAGGAGG + Intergenic
1062179915 9:135185776-135185798 CAGTGGCCTTAGGGGGAAGCCGG - Intergenic
1062362757 9:136195450-136195472 CAGTGGACGGGGAGGGAAGGTGG - Intergenic
1062385748 9:136310877-136310899 CAGTGGCCCTGGGGGGTGCCGGG - Intergenic
1062405850 9:136395907-136395929 AAGTGACCCTGGTGGGCAGCGGG + Intronic
1062541801 9:137044857-137044879 CAGTGCCCCTGGATGGGAGGTGG - Intronic
1062544560 9:137055660-137055682 CGCTGGGCCTGGAGGGAAGCGGG - Intergenic
1062694241 9:137865015-137865037 CTGTGGCCTGTGAGGGAAGCGGG + Intronic
1062741837 9:138179523-138179545 CAGGGGCCCAGGAGGGAACAGGG + Intergenic
1186776363 X:12868581-12868603 CAGTGGCCCTGGAAGGCAACAGG - Intronic
1186924816 X:14321971-14321993 CAGTTGACCTGGAGGGGAGAAGG - Intergenic
1187430198 X:19216071-19216093 CACATGCCCTGGAGGGAAACTGG + Intergenic
1187433577 X:19246943-19246965 CTGTAGCCCTGGAGTGAAGAGGG - Intergenic
1187500181 X:19832908-19832930 CAGTGACTGTGGAGGGAACCAGG - Intronic
1189213922 X:39307129-39307151 CAGAGGCCATGGAGTCAAGCTGG + Intergenic
1189316862 X:40062710-40062732 CACAGGCCCCAGAGGGAAGCCGG + Intronic
1192788049 X:74354063-74354085 CTGTGGCCATGGAGGCCAGCTGG - Intergenic
1193644263 X:84047597-84047619 CAGTGGGCTTGGAGGGGAGTGGG - Intergenic
1196856548 X:119990583-119990605 GTGTGGCCCTGGAGGCAGGCGGG - Intergenic
1197774237 X:130109748-130109770 CGGCGGCCCAGGAGGGAACCCGG + Intronic
1199864111 X:151827636-151827658 CTGTGGGCCTGGAAGGAAGGAGG - Intergenic
1200012109 X:153127109-153127131 CAGGGACCCTGCAGGGAAACAGG - Intergenic
1200027491 X:153272810-153272832 CAGGGACCCTGCAGGGAAACAGG + Intergenic
1200077086 X:153556564-153556586 CAGGGGCCCATGAGGGAACCAGG + Intronic
1202584389 Y:26408646-26408668 CACTGGCCTTGGCGGGGAGCCGG - Intergenic