ID: 1175345472

View in Genome Browser
Species Human (GRCh38)
Location 20:58270177-58270199
Sequence TGCCCCCGATTTGATATAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175345469_1175345472 19 Left 1175345469 20:58270135-58270157 CCAAATTCAGCATTAGGAAAAGA No data
Right 1175345472 20:58270177-58270199 TGCCCCCGATTTGATATAGCAGG No data
1175345470_1175345472 -7 Left 1175345470 20:58270161-58270183 CCATCCAGAGCTTTTCTGCCCCC No data
Right 1175345472 20:58270177-58270199 TGCCCCCGATTTGATATAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175345472 Original CRISPR TGCCCCCGATTTGATATAGC AGG Intergenic
No off target data available for this crispr