ID: 1175349803

View in Genome Browser
Species Human (GRCh38)
Location 20:58309758-58309780
Sequence GGGACGCCGCCGCGGCCTTC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 121}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175349803_1175349813 12 Left 1175349803 20:58309758-58309780 CCGGAAGGCCGCGGCGGCGTCCC 0: 1
1: 0
2: 0
3: 4
4: 121
Right 1175349813 20:58309793-58309815 GGGCCCCACGCGGCTGGCAGCGG 0: 1
1: 0
2: 0
3: 19
4: 218
1175349803_1175349819 29 Left 1175349803 20:58309758-58309780 CCGGAAGGCCGCGGCGGCGTCCC 0: 1
1: 0
2: 0
3: 4
4: 121
Right 1175349819 20:58309810-58309832 CAGCGGACAGGCCGGACCTACGG 0: 1
1: 0
2: 0
3: 5
4: 69
1175349803_1175349812 6 Left 1175349803 20:58309758-58309780 CCGGAAGGCCGCGGCGGCGTCCC 0: 1
1: 0
2: 0
3: 4
4: 121
Right 1175349812 20:58309787-58309809 TAAGGCGGGCCCCACGCGGCTGG 0: 1
1: 0
2: 0
3: 3
4: 57
1175349803_1175349817 17 Left 1175349803 20:58309758-58309780 CCGGAAGGCCGCGGCGGCGTCCC 0: 1
1: 0
2: 0
3: 4
4: 121
Right 1175349817 20:58309798-58309820 CCACGCGGCTGGCAGCGGACAGG 0: 1
1: 0
2: 0
3: 5
4: 82
1175349803_1175349807 -9 Left 1175349803 20:58309758-58309780 CCGGAAGGCCGCGGCGGCGTCCC 0: 1
1: 0
2: 0
3: 4
4: 121
Right 1175349807 20:58309772-58309794 CGGCGTCCCGGCTGCTAAGGCGG 0: 1
1: 0
2: 0
3: 6
4: 214
1175349803_1175349818 21 Left 1175349803 20:58309758-58309780 CCGGAAGGCCGCGGCGGCGTCCC 0: 1
1: 0
2: 0
3: 4
4: 121
Right 1175349818 20:58309802-58309824 GCGGCTGGCAGCGGACAGGCCGG 0: 1
1: 0
2: 0
3: 16
4: 274
1175349803_1175349811 2 Left 1175349803 20:58309758-58309780 CCGGAAGGCCGCGGCGGCGTCCC 0: 1
1: 0
2: 0
3: 4
4: 121
Right 1175349811 20:58309783-58309805 CTGCTAAGGCGGGCCCCACGCGG 0: 1
1: 0
2: 1
3: 5
4: 50
1175349803_1175349808 -8 Left 1175349803 20:58309758-58309780 CCGGAAGGCCGCGGCGGCGTCCC 0: 1
1: 0
2: 0
3: 4
4: 121
Right 1175349808 20:58309773-58309795 GGCGTCCCGGCTGCTAAGGCGGG 0: 1
1: 0
2: 0
3: 4
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175349803 Original CRISPR GGGACGCCGCCGCGGCCTTC CGG (reversed) Exonic