ID: 1175349805

View in Genome Browser
Species Human (GRCh38)
Location 20:58309766-58309788
Sequence TAGCAGCCGGGACGCCGCCG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 78}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175349805_1175349817 9 Left 1175349805 20:58309766-58309788 CCGCGGCGGCGTCCCGGCTGCTA 0: 1
1: 0
2: 0
3: 4
4: 78
Right 1175349817 20:58309798-58309820 CCACGCGGCTGGCAGCGGACAGG 0: 1
1: 0
2: 0
3: 5
4: 82
1175349805_1175349813 4 Left 1175349805 20:58309766-58309788 CCGCGGCGGCGTCCCGGCTGCTA 0: 1
1: 0
2: 0
3: 4
4: 78
Right 1175349813 20:58309793-58309815 GGGCCCCACGCGGCTGGCAGCGG 0: 1
1: 0
2: 0
3: 19
4: 218
1175349805_1175349812 -2 Left 1175349805 20:58309766-58309788 CCGCGGCGGCGTCCCGGCTGCTA 0: 1
1: 0
2: 0
3: 4
4: 78
Right 1175349812 20:58309787-58309809 TAAGGCGGGCCCCACGCGGCTGG 0: 1
1: 0
2: 0
3: 3
4: 57
1175349805_1175349820 25 Left 1175349805 20:58309766-58309788 CCGCGGCGGCGTCCCGGCTGCTA 0: 1
1: 0
2: 0
3: 4
4: 78
Right 1175349820 20:58309814-58309836 GGACAGGCCGGACCTACGGCCGG 0: 1
1: 0
2: 0
3: 8
4: 72
1175349805_1175349818 13 Left 1175349805 20:58309766-58309788 CCGCGGCGGCGTCCCGGCTGCTA 0: 1
1: 0
2: 0
3: 4
4: 78
Right 1175349818 20:58309802-58309824 GCGGCTGGCAGCGGACAGGCCGG 0: 1
1: 0
2: 0
3: 16
4: 274
1175349805_1175349819 21 Left 1175349805 20:58309766-58309788 CCGCGGCGGCGTCCCGGCTGCTA 0: 1
1: 0
2: 0
3: 4
4: 78
Right 1175349819 20:58309810-58309832 CAGCGGACAGGCCGGACCTACGG 0: 1
1: 0
2: 0
3: 5
4: 69
1175349805_1175349811 -6 Left 1175349805 20:58309766-58309788 CCGCGGCGGCGTCCCGGCTGCTA 0: 1
1: 0
2: 0
3: 4
4: 78
Right 1175349811 20:58309783-58309805 CTGCTAAGGCGGGCCCCACGCGG 0: 1
1: 0
2: 1
3: 5
4: 50
1175349805_1175349821 28 Left 1175349805 20:58309766-58309788 CCGCGGCGGCGTCCCGGCTGCTA 0: 1
1: 0
2: 0
3: 4
4: 78
Right 1175349821 20:58309817-58309839 CAGGCCGGACCTACGGCCGGAGG 0: 1
1: 0
2: 1
3: 2
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175349805 Original CRISPR TAGCAGCCGGGACGCCGCCG CGG (reversed) Exonic