ID: 1175349809

View in Genome Browser
Species Human (GRCh38)
Location 20:58309778-58309800
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 105}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175349809_1175349818 1 Left 1175349809 20:58309778-58309800 CCCGGCTGCTAAGGCGGGCCCCA 0: 1
1: 0
2: 0
3: 10
4: 105
Right 1175349818 20:58309802-58309824 GCGGCTGGCAGCGGACAGGCCGG 0: 1
1: 0
2: 0
3: 16
4: 274
1175349809_1175349824 21 Left 1175349809 20:58309778-58309800 CCCGGCTGCTAAGGCGGGCCCCA 0: 1
1: 0
2: 0
3: 10
4: 105
Right 1175349824 20:58309822-58309844 CGGACCTACGGCCGGAGGACGGG 0: 1
1: 0
2: 1
3: 2
4: 34
1175349809_1175349817 -3 Left 1175349809 20:58309778-58309800 CCCGGCTGCTAAGGCGGGCCCCA 0: 1
1: 0
2: 0
3: 10
4: 105
Right 1175349817 20:58309798-58309820 CCACGCGGCTGGCAGCGGACAGG 0: 1
1: 0
2: 0
3: 5
4: 82
1175349809_1175349821 16 Left 1175349809 20:58309778-58309800 CCCGGCTGCTAAGGCGGGCCCCA 0: 1
1: 0
2: 0
3: 10
4: 105
Right 1175349821 20:58309817-58309839 CAGGCCGGACCTACGGCCGGAGG 0: 1
1: 0
2: 1
3: 2
4: 63
1175349809_1175349820 13 Left 1175349809 20:58309778-58309800 CCCGGCTGCTAAGGCGGGCCCCA 0: 1
1: 0
2: 0
3: 10
4: 105
Right 1175349820 20:58309814-58309836 GGACAGGCCGGACCTACGGCCGG 0: 1
1: 0
2: 0
3: 8
4: 72
1175349809_1175349825 24 Left 1175349809 20:58309778-58309800 CCCGGCTGCTAAGGCGGGCCCCA 0: 1
1: 0
2: 0
3: 10
4: 105
Right 1175349825 20:58309825-58309847 ACCTACGGCCGGAGGACGGGCGG 0: 1
1: 0
2: 1
3: 4
4: 36
1175349809_1175349813 -8 Left 1175349809 20:58309778-58309800 CCCGGCTGCTAAGGCGGGCCCCA 0: 1
1: 0
2: 0
3: 10
4: 105
Right 1175349813 20:58309793-58309815 GGGCCCCACGCGGCTGGCAGCGG 0: 1
1: 0
2: 0
3: 19
4: 218
1175349809_1175349823 20 Left 1175349809 20:58309778-58309800 CCCGGCTGCTAAGGCGGGCCCCA 0: 1
1: 0
2: 0
3: 10
4: 105
Right 1175349823 20:58309821-58309843 CCGGACCTACGGCCGGAGGACGG 0: 1
1: 0
2: 0
3: 3
4: 30
1175349809_1175349819 9 Left 1175349809 20:58309778-58309800 CCCGGCTGCTAAGGCGGGCCCCA 0: 1
1: 0
2: 0
3: 10
4: 105
Right 1175349819 20:58309810-58309832 CAGCGGACAGGCCGGACCTACGG 0: 1
1: 0
2: 0
3: 5
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175349809 Original CRISPR TGGGGCCCGCCTTAGCAGCC GGG (reversed) Exonic