ID: 1175349813

View in Genome Browser
Species Human (GRCh38)
Location 20:58309793-58309815
Sequence GGGCCCCACGCGGCTGGCAG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 218}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175349802_1175349813 13 Left 1175349802 20:58309757-58309779 CCCGGAAGGCCGCGGCGGCGTCC 0: 1
1: 0
2: 0
3: 16
4: 177
Right 1175349813 20:58309793-58309815 GGGCCCCACGCGGCTGGCAGCGG 0: 1
1: 0
2: 0
3: 19
4: 218
1175349809_1175349813 -8 Left 1175349809 20:58309778-58309800 CCCGGCTGCTAAGGCGGGCCCCA 0: 1
1: 0
2: 0
3: 10
4: 105
Right 1175349813 20:58309793-58309815 GGGCCCCACGCGGCTGGCAGCGG 0: 1
1: 0
2: 0
3: 19
4: 218
1175349805_1175349813 4 Left 1175349805 20:58309766-58309788 CCGCGGCGGCGTCCCGGCTGCTA 0: 1
1: 0
2: 0
3: 4
4: 78
Right 1175349813 20:58309793-58309815 GGGCCCCACGCGGCTGGCAGCGG 0: 1
1: 0
2: 0
3: 19
4: 218
1175349803_1175349813 12 Left 1175349803 20:58309758-58309780 CCGGAAGGCCGCGGCGGCGTCCC 0: 1
1: 0
2: 0
3: 4
4: 121
Right 1175349813 20:58309793-58309815 GGGCCCCACGCGGCTGGCAGCGG 0: 1
1: 0
2: 0
3: 19
4: 218
1175349810_1175349813 -9 Left 1175349810 20:58309779-58309801 CCGGCTGCTAAGGCGGGCCCCAC 0: 1
1: 0
2: 0
3: 11
4: 75
Right 1175349813 20:58309793-58309815 GGGCCCCACGCGGCTGGCAGCGG 0: 1
1: 0
2: 0
3: 19
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175349813 Original CRISPR GGGCCCCACGCGGCTGGCAG CGG Exonic