ID: 1175349816

View in Genome Browser
Species Human (GRCh38)
Location 20:58309798-58309820
Sequence CCTGTCCGCTGCCAGCCGCG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 99}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175349816_1175349823 0 Left 1175349816 20:58309798-58309820 CCACGCGGCTGGCAGCGGACAGG 0: 1
1: 0
2: 0
3: 10
4: 99
Right 1175349823 20:58309821-58309843 CCGGACCTACGGCCGGAGGACGG 0: 1
1: 0
2: 0
3: 3
4: 30
1175349816_1175349828 21 Left 1175349816 20:58309798-58309820 CCACGCGGCTGGCAGCGGACAGG 0: 1
1: 0
2: 0
3: 10
4: 99
Right 1175349828 20:58309842-58309864 GGGCGGCAGCCGCCTCTGCGCGG 0: 1
1: 1
2: 2
3: 63
4: 269
1175349816_1175349824 1 Left 1175349816 20:58309798-58309820 CCACGCGGCTGGCAGCGGACAGG 0: 1
1: 0
2: 0
3: 10
4: 99
Right 1175349824 20:58309822-58309844 CGGACCTACGGCCGGAGGACGGG 0: 1
1: 0
2: 1
3: 2
4: 34
1175349816_1175349830 27 Left 1175349816 20:58309798-58309820 CCACGCGGCTGGCAGCGGACAGG 0: 1
1: 0
2: 0
3: 10
4: 99
Right 1175349830 20:58309848-58309870 CAGCCGCCTCTGCGCGGACCGGG 0: 1
1: 0
2: 0
3: 14
4: 161
1175349816_1175349831 28 Left 1175349816 20:58309798-58309820 CCACGCGGCTGGCAGCGGACAGG 0: 1
1: 0
2: 0
3: 10
4: 99
Right 1175349831 20:58309849-58309871 AGCCGCCTCTGCGCGGACCGGGG 0: 1
1: 0
2: 0
3: 14
4: 70
1175349816_1175349825 4 Left 1175349816 20:58309798-58309820 CCACGCGGCTGGCAGCGGACAGG 0: 1
1: 0
2: 0
3: 10
4: 99
Right 1175349825 20:58309825-58309847 ACCTACGGCCGGAGGACGGGCGG 0: 1
1: 0
2: 1
3: 4
4: 36
1175349816_1175349829 26 Left 1175349816 20:58309798-58309820 CCACGCGGCTGGCAGCGGACAGG 0: 1
1: 0
2: 0
3: 10
4: 99
Right 1175349829 20:58309847-58309869 GCAGCCGCCTCTGCGCGGACCGG 0: 1
1: 0
2: 1
3: 9
4: 88
1175349816_1175349821 -4 Left 1175349816 20:58309798-58309820 CCACGCGGCTGGCAGCGGACAGG 0: 1
1: 0
2: 0
3: 10
4: 99
Right 1175349821 20:58309817-58309839 CAGGCCGGACCTACGGCCGGAGG 0: 1
1: 0
2: 1
3: 2
4: 63
1175349816_1175349820 -7 Left 1175349816 20:58309798-58309820 CCACGCGGCTGGCAGCGGACAGG 0: 1
1: 0
2: 0
3: 10
4: 99
Right 1175349820 20:58309814-58309836 GGACAGGCCGGACCTACGGCCGG 0: 1
1: 0
2: 0
3: 8
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175349816 Original CRISPR CCTGTCCGCTGCCAGCCGCG TGG (reversed) Exonic