ID: 1175349817

View in Genome Browser
Species Human (GRCh38)
Location 20:58309798-58309820
Sequence CCACGCGGCTGGCAGCGGAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 82}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175349803_1175349817 17 Left 1175349803 20:58309758-58309780 CCGGAAGGCCGCGGCGGCGTCCC 0: 1
1: 0
2: 0
3: 4
4: 121
Right 1175349817 20:58309798-58309820 CCACGCGGCTGGCAGCGGACAGG 0: 1
1: 0
2: 0
3: 5
4: 82
1175349809_1175349817 -3 Left 1175349809 20:58309778-58309800 CCCGGCTGCTAAGGCGGGCCCCA 0: 1
1: 0
2: 0
3: 10
4: 105
Right 1175349817 20:58309798-58309820 CCACGCGGCTGGCAGCGGACAGG 0: 1
1: 0
2: 0
3: 5
4: 82
1175349805_1175349817 9 Left 1175349805 20:58309766-58309788 CCGCGGCGGCGTCCCGGCTGCTA 0: 1
1: 0
2: 0
3: 4
4: 78
Right 1175349817 20:58309798-58309820 CCACGCGGCTGGCAGCGGACAGG 0: 1
1: 0
2: 0
3: 5
4: 82
1175349802_1175349817 18 Left 1175349802 20:58309757-58309779 CCCGGAAGGCCGCGGCGGCGTCC 0: 1
1: 0
2: 0
3: 16
4: 177
Right 1175349817 20:58309798-58309820 CCACGCGGCTGGCAGCGGACAGG 0: 1
1: 0
2: 0
3: 5
4: 82
1175349810_1175349817 -4 Left 1175349810 20:58309779-58309801 CCGGCTGCTAAGGCGGGCCCCAC 0: 1
1: 0
2: 0
3: 11
4: 75
Right 1175349817 20:58309798-58309820 CCACGCGGCTGGCAGCGGACAGG 0: 1
1: 0
2: 0
3: 5
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175349817 Original CRISPR CCACGCGGCTGGCAGCGGAC AGG Exonic