ID: 1175349819

View in Genome Browser
Species Human (GRCh38)
Location 20:58309810-58309832
Sequence CAGCGGACAGGCCGGACCTA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 69}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175349814_1175349819 -9 Left 1175349814 20:58309796-58309818 CCCCACGCGGCTGGCAGCGGACA 0: 1
1: 0
2: 2
3: 5
4: 58
Right 1175349819 20:58309810-58309832 CAGCGGACAGGCCGGACCTACGG 0: 1
1: 0
2: 0
3: 5
4: 69
1175349802_1175349819 30 Left 1175349802 20:58309757-58309779 CCCGGAAGGCCGCGGCGGCGTCC 0: 1
1: 0
2: 0
3: 16
4: 177
Right 1175349819 20:58309810-58309832 CAGCGGACAGGCCGGACCTACGG 0: 1
1: 0
2: 0
3: 5
4: 69
1175349809_1175349819 9 Left 1175349809 20:58309778-58309800 CCCGGCTGCTAAGGCGGGCCCCA 0: 1
1: 0
2: 0
3: 10
4: 105
Right 1175349819 20:58309810-58309832 CAGCGGACAGGCCGGACCTACGG 0: 1
1: 0
2: 0
3: 5
4: 69
1175349815_1175349819 -10 Left 1175349815 20:58309797-58309819 CCCACGCGGCTGGCAGCGGACAG 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1175349819 20:58309810-58309832 CAGCGGACAGGCCGGACCTACGG 0: 1
1: 0
2: 0
3: 5
4: 69
1175349805_1175349819 21 Left 1175349805 20:58309766-58309788 CCGCGGCGGCGTCCCGGCTGCTA 0: 1
1: 0
2: 0
3: 4
4: 78
Right 1175349819 20:58309810-58309832 CAGCGGACAGGCCGGACCTACGG 0: 1
1: 0
2: 0
3: 5
4: 69
1175349810_1175349819 8 Left 1175349810 20:58309779-58309801 CCGGCTGCTAAGGCGGGCCCCAC 0: 1
1: 0
2: 0
3: 11
4: 75
Right 1175349819 20:58309810-58309832 CAGCGGACAGGCCGGACCTACGG 0: 1
1: 0
2: 0
3: 5
4: 69
1175349803_1175349819 29 Left 1175349803 20:58309758-58309780 CCGGAAGGCCGCGGCGGCGTCCC 0: 1
1: 0
2: 0
3: 4
4: 121
Right 1175349819 20:58309810-58309832 CAGCGGACAGGCCGGACCTACGG 0: 1
1: 0
2: 0
3: 5
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175349819 Original CRISPR CAGCGGACAGGCCGGACCTA CGG Exonic