ID: 1175349822

View in Genome Browser
Species Human (GRCh38)
Location 20:58309821-58309843
Sequence CCGTCCTCCGGCCGTAGGTC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 31}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175349822_1175349839 27 Left 1175349822 20:58309821-58309843 CCGGACCTACGGCCGGAGGACGG 0: 1
1: 0
2: 1
3: 1
4: 31
Right 1175349839 20:58309871-58309893 GCTGGGCCGTGCGGCGGCAGCGG 0: 1
1: 0
2: 1
3: 34
4: 335
1175349822_1175349828 -2 Left 1175349822 20:58309821-58309843 CCGGACCTACGGCCGGAGGACGG 0: 1
1: 0
2: 1
3: 1
4: 31
Right 1175349828 20:58309842-58309864 GGGCGGCAGCCGCCTCTGCGCGG 0: 1
1: 1
2: 2
3: 63
4: 269
1175349822_1175349831 5 Left 1175349822 20:58309821-58309843 CCGGACCTACGGCCGGAGGACGG 0: 1
1: 0
2: 1
3: 1
4: 31
Right 1175349831 20:58309849-58309871 AGCCGCCTCTGCGCGGACCGGGG 0: 1
1: 0
2: 0
3: 14
4: 70
1175349822_1175349835 10 Left 1175349822 20:58309821-58309843 CCGGACCTACGGCCGGAGGACGG 0: 1
1: 0
2: 1
3: 1
4: 31
Right 1175349835 20:58309854-58309876 CCTCTGCGCGGACCGGGGCTGGG 0: 1
1: 0
2: 1
3: 11
4: 132
1175349822_1175349837 21 Left 1175349822 20:58309821-58309843 CCGGACCTACGGCCGGAGGACGG 0: 1
1: 0
2: 1
3: 1
4: 31
Right 1175349837 20:58309865-58309887 ACCGGGGCTGGGCCGTGCGGCGG 0: 1
1: 0
2: 2
3: 29
4: 247
1175349822_1175349833 9 Left 1175349822 20:58309821-58309843 CCGGACCTACGGCCGGAGGACGG 0: 1
1: 0
2: 1
3: 1
4: 31
Right 1175349833 20:58309853-58309875 GCCTCTGCGCGGACCGGGGCTGG 0: 1
1: 1
2: 0
3: 12
4: 142
1175349822_1175349830 4 Left 1175349822 20:58309821-58309843 CCGGACCTACGGCCGGAGGACGG 0: 1
1: 0
2: 1
3: 1
4: 31
Right 1175349830 20:58309848-58309870 CAGCCGCCTCTGCGCGGACCGGG 0: 1
1: 0
2: 0
3: 14
4: 161
1175349822_1175349829 3 Left 1175349822 20:58309821-58309843 CCGGACCTACGGCCGGAGGACGG 0: 1
1: 0
2: 1
3: 1
4: 31
Right 1175349829 20:58309847-58309869 GCAGCCGCCTCTGCGCGGACCGG 0: 1
1: 0
2: 1
3: 9
4: 88
1175349822_1175349836 18 Left 1175349822 20:58309821-58309843 CCGGACCTACGGCCGGAGGACGG 0: 1
1: 0
2: 1
3: 1
4: 31
Right 1175349836 20:58309862-58309884 CGGACCGGGGCTGGGCCGTGCGG 0: 1
1: 0
2: 1
3: 25
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175349822 Original CRISPR CCGTCCTCCGGCCGTAGGTC CGG (reversed) Exonic