ID: 1175349825

View in Genome Browser
Species Human (GRCh38)
Location 20:58309825-58309847
Sequence ACCTACGGCCGGAGGACGGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 36}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175349809_1175349825 24 Left 1175349809 20:58309778-58309800 CCCGGCTGCTAAGGCGGGCCCCA 0: 1
1: 0
2: 0
3: 10
4: 105
Right 1175349825 20:58309825-58309847 ACCTACGGCCGGAGGACGGGCGG 0: 1
1: 0
2: 1
3: 4
4: 36
1175349815_1175349825 5 Left 1175349815 20:58309797-58309819 CCCACGCGGCTGGCAGCGGACAG 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1175349825 20:58309825-58309847 ACCTACGGCCGGAGGACGGGCGG 0: 1
1: 0
2: 1
3: 4
4: 36
1175349814_1175349825 6 Left 1175349814 20:58309796-58309818 CCCCACGCGGCTGGCAGCGGACA 0: 1
1: 0
2: 2
3: 5
4: 58
Right 1175349825 20:58309825-58309847 ACCTACGGCCGGAGGACGGGCGG 0: 1
1: 0
2: 1
3: 4
4: 36
1175349816_1175349825 4 Left 1175349816 20:58309798-58309820 CCACGCGGCTGGCAGCGGACAGG 0: 1
1: 0
2: 0
3: 10
4: 99
Right 1175349825 20:58309825-58309847 ACCTACGGCCGGAGGACGGGCGG 0: 1
1: 0
2: 1
3: 4
4: 36
1175349810_1175349825 23 Left 1175349810 20:58309779-58309801 CCGGCTGCTAAGGCGGGCCCCAC 0: 1
1: 0
2: 0
3: 11
4: 75
Right 1175349825 20:58309825-58309847 ACCTACGGCCGGAGGACGGGCGG 0: 1
1: 0
2: 1
3: 4
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175349825 Original CRISPR ACCTACGGCCGGAGGACGGG CGG Exonic