ID: 1175349828

View in Genome Browser
Species Human (GRCh38)
Location 20:58309842-58309864
Sequence GGGCGGCAGCCGCCTCTGCG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 1, 1: 1, 2: 2, 3: 63, 4: 269}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175349816_1175349828 21 Left 1175349816 20:58309798-58309820 CCACGCGGCTGGCAGCGGACAGG 0: 1
1: 0
2: 0
3: 10
4: 99
Right 1175349828 20:58309842-58309864 GGGCGGCAGCCGCCTCTGCGCGG 0: 1
1: 1
2: 2
3: 63
4: 269
1175349815_1175349828 22 Left 1175349815 20:58309797-58309819 CCCACGCGGCTGGCAGCGGACAG 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1175349828 20:58309842-58309864 GGGCGGCAGCCGCCTCTGCGCGG 0: 1
1: 1
2: 2
3: 63
4: 269
1175349822_1175349828 -2 Left 1175349822 20:58309821-58309843 CCGGACCTACGGCCGGAGGACGG 0: 1
1: 0
2: 1
3: 1
4: 31
Right 1175349828 20:58309842-58309864 GGGCGGCAGCCGCCTCTGCGCGG 0: 1
1: 1
2: 2
3: 63
4: 269
1175349826_1175349828 -7 Left 1175349826 20:58309826-58309848 CCTACGGCCGGAGGACGGGCGGC 0: 1
1: 0
2: 2
3: 9
4: 69
Right 1175349828 20:58309842-58309864 GGGCGGCAGCCGCCTCTGCGCGG 0: 1
1: 1
2: 2
3: 63
4: 269
1175349814_1175349828 23 Left 1175349814 20:58309796-58309818 CCCCACGCGGCTGGCAGCGGACA 0: 1
1: 0
2: 2
3: 5
4: 58
Right 1175349828 20:58309842-58309864 GGGCGGCAGCCGCCTCTGCGCGG 0: 1
1: 1
2: 2
3: 63
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175349828 Original CRISPR GGGCGGCAGCCGCCTCTGCG CGG Exonic