ID: 1175349831

View in Genome Browser
Species Human (GRCh38)
Location 20:58309849-58309871
Sequence AGCCGCCTCTGCGCGGACCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 70}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175349815_1175349831 29 Left 1175349815 20:58309797-58309819 CCCACGCGGCTGGCAGCGGACAG 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1175349831 20:58309849-58309871 AGCCGCCTCTGCGCGGACCGGGG 0: 1
1: 0
2: 0
3: 14
4: 70
1175349814_1175349831 30 Left 1175349814 20:58309796-58309818 CCCCACGCGGCTGGCAGCGGACA 0: 1
1: 0
2: 2
3: 5
4: 58
Right 1175349831 20:58309849-58309871 AGCCGCCTCTGCGCGGACCGGGG 0: 1
1: 0
2: 0
3: 14
4: 70
1175349826_1175349831 0 Left 1175349826 20:58309826-58309848 CCTACGGCCGGAGGACGGGCGGC 0: 1
1: 0
2: 2
3: 9
4: 69
Right 1175349831 20:58309849-58309871 AGCCGCCTCTGCGCGGACCGGGG 0: 1
1: 0
2: 0
3: 14
4: 70
1175349816_1175349831 28 Left 1175349816 20:58309798-58309820 CCACGCGGCTGGCAGCGGACAGG 0: 1
1: 0
2: 0
3: 10
4: 99
Right 1175349831 20:58309849-58309871 AGCCGCCTCTGCGCGGACCGGGG 0: 1
1: 0
2: 0
3: 14
4: 70
1175349822_1175349831 5 Left 1175349822 20:58309821-58309843 CCGGACCTACGGCCGGAGGACGG 0: 1
1: 0
2: 1
3: 1
4: 31
Right 1175349831 20:58309849-58309871 AGCCGCCTCTGCGCGGACCGGGG 0: 1
1: 0
2: 0
3: 14
4: 70
1175349827_1175349831 -7 Left 1175349827 20:58309833-58309855 CCGGAGGACGGGCGGCAGCCGCC 0: 1
1: 0
2: 1
3: 11
4: 140
Right 1175349831 20:58309849-58309871 AGCCGCCTCTGCGCGGACCGGGG 0: 1
1: 0
2: 0
3: 14
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175349831 Original CRISPR AGCCGCCTCTGCGCGGACCG GGG Exonic