ID: 1175352538

View in Genome Browser
Species Human (GRCh38)
Location 20:58335212-58335234
Sequence AGAAACGGCTTGTGTGGAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 99}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175352531_1175352538 14 Left 1175352531 20:58335175-58335197 CCAAGGACAGTTAACCCTCATCT 0: 1
1: 0
2: 0
3: 11
4: 95
Right 1175352538 20:58335212-58335234 AGAAACGGCTTGTGTGGAATGGG 0: 1
1: 0
2: 0
3: 13
4: 99
1175352533_1175352538 0 Left 1175352533 20:58335189-58335211 CCCTCATCTCTGAAGTGGAAGTC No data
Right 1175352538 20:58335212-58335234 AGAAACGGCTTGTGTGGAATGGG 0: 1
1: 0
2: 0
3: 13
4: 99
1175352530_1175352538 29 Left 1175352530 20:58335160-58335182 CCATTTATTTGAAATCCAAGGAC 0: 1
1: 0
2: 1
3: 44
4: 381
Right 1175352538 20:58335212-58335234 AGAAACGGCTTGTGTGGAATGGG 0: 1
1: 0
2: 0
3: 13
4: 99
1175352534_1175352538 -1 Left 1175352534 20:58335190-58335212 CCTCATCTCTGAAGTGGAAGTCA 0: 1
1: 2
2: 6
3: 55
4: 545
Right 1175352538 20:58335212-58335234 AGAAACGGCTTGTGTGGAATGGG 0: 1
1: 0
2: 0
3: 13
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175352538 Original CRISPR AGAAACGGCTTGTGTGGAAT GGG Intronic
901412204 1:9092372-9092394 GGAAATGGCTAGTGTGGAAGAGG - Intergenic
905399049 1:37688451-37688473 AAGTACGGCTTGTGTGGAGTGGG - Intronic
916711726 1:167416648-167416670 GGAAGGGGCGTGTGTGGAATGGG - Exonic
918631391 1:186723208-186723230 AGGAACAGCTTGATTGGAATGGG + Intergenic
1068078313 10:52286189-52286211 AAACACGGCATGTGTGGTATTGG + Intronic
1070805903 10:79270596-79270618 AGTCACGGCTGGTGTGGAGTGGG + Intronic
1071867864 10:89756366-89756388 AGAAACCACTGGTTTGGAATTGG - Intronic
1072961616 10:99934395-99934417 AAAACCTCCTTGTGTGGAATAGG + Intronic
1072964710 10:99961961-99961983 AAAACCTCCTTGTGTGGAATAGG - Intronic
1075355291 10:121766906-121766928 CGAAAGGGATTGTGTGGAATGGG - Intronic
1075471299 10:122692034-122692056 AGAGACAGCATGTGTGGAAATGG - Intergenic
1080907363 11:36560347-36560369 AGAAACAGGTAGTGTAGAATAGG - Intronic
1085183591 11:74556915-74556937 AGAAACAGCTGCTATGGAATAGG - Intronic
1085975677 11:81650959-81650981 TGAAAGGGATTGTGTAGAATTGG - Intergenic
1087919854 11:103854349-103854371 AAAAATAGCTTGTGTGTAATGGG - Intergenic
1088455518 11:110029149-110029171 AGAAAGGGGTGGTGTGGGATGGG - Intergenic
1089940360 11:122410322-122410344 AGAAACAGCTTATGAGGAAAGGG - Intergenic
1092217689 12:6694425-6694447 AGAAACAAATGGTGTGGAATGGG + Exonic
1094878348 12:34679023-34679045 AGAATCTGCTTGTGTAGATTTGG + Intergenic
1108431754 13:50360432-50360454 AGAAACACCTTGTGTGGAGTAGG - Intronic
1108579090 13:51813567-51813589 AGAAACCGCATGTGTGCACTCGG - Intergenic
1117984622 14:61374995-61375017 AGAAAGGGATGGTGTGAAATTGG - Intronic
1120016171 14:79476216-79476238 AGAAACTGATTCTGTGGAGTGGG - Intronic
1120237121 14:81904586-81904608 AGAAAGGGCTTGTCTTGACTGGG - Intergenic
1121010213 14:90515791-90515813 AGATCCGGCTTCTGTGGAGTTGG + Intergenic
1122409416 14:101518343-101518365 AGAAAGGGCATGTGTGGCCTGGG + Intergenic
1125740404 15:41959095-41959117 AGAAATGGTTTGTGTGGGCTGGG + Intronic
1126320701 15:47419652-47419674 TGAAAGGGCTTTAGTGGAATGGG + Intronic
1129412540 15:75358131-75358153 GGAGACTGCTTGTGTGGAACAGG - Intronic
1129653230 15:77506244-77506266 AGAGACGGCTTGGCTGGGATCGG - Intergenic
1131301077 15:91200101-91200123 AGAAAAGGCTTGAATGCAATAGG - Intronic
1133337940 16:5018369-5018391 AGAAACTGCTTGTGTGGGCGGGG + Exonic
1137783632 16:51119033-51119055 AGAGTTGGCTTGTGTGGTATAGG - Intergenic
1137937603 16:52649486-52649508 AGAAAGGGCATGGGTGGAACTGG + Intergenic
1148274005 17:46287342-46287364 TGAAATGGCTTCTGTGGAATAGG - Intronic
1150409051 17:64927235-64927257 TGAAATGGCTTCTGTGGAATAGG + Intergenic
1150544776 17:66144270-66144292 AAATACTGCTTGTCTGGAATTGG - Intronic
1150761165 17:67962932-67962954 TGAAATGGCTTCTGTGGAATAGG + Intronic
1157772305 18:50359741-50359763 AGAAATGCATTGTGTGGAGTGGG + Intergenic
1158318103 18:56234762-56234784 AGAATGGGCTTGAGTAGAATGGG - Intergenic
1162916066 19:13874986-13875008 AGACACGGCTTAAGGGGAATGGG + Intronic
1165934686 19:39382055-39382077 AGATAAGGCTCGTCTGGAATGGG + Intronic
926439297 2:12870914-12870936 AGAAACTGCTTGTCTGGAAGTGG - Intergenic
933610372 2:84428195-84428217 AGAAAAGGCTTATGGGGAAGAGG - Intronic
933714737 2:85351659-85351681 AGGTAAGGCTTGTGTGGAAAAGG - Exonic
939587100 2:144019181-144019203 AGATACGGCTTGAATGGACTGGG + Intronic
940795186 2:158070322-158070344 AGAGATGGCTTGTCTAGAATGGG - Intronic
944611795 2:201417138-201417160 GGAAAAAGTTTGTGTGGAATTGG - Intronic
944716395 2:202379639-202379661 AGAGAGGGCCTGTGTGGATTTGG + Intronic
1170480857 20:16763664-16763686 AAAAAGGGCTTCTGTGGCATAGG + Intronic
1172519784 20:35559188-35559210 AGAAACGGCCAGTGGGGAAGGGG - Intergenic
1175352538 20:58335212-58335234 AGAAACGGCTTGTGTGGAATGGG + Intronic
1176751894 21:10697700-10697722 AGAATGGGCTTGATTGGAATGGG - Intergenic
1176919165 21:14665755-14665777 AGCAATGGCTTTTGAGGAATGGG - Intergenic
1178662860 21:34521603-34521625 AGAAACTGCTTGTCTGGATTTGG + Exonic
1178975134 21:37214694-37214716 TGAAAGAGTTTGTGTGGAATTGG + Intergenic
1181619078 22:24075774-24075796 AGAAATGGCATGTGTAGTATGGG + Intronic
1181874999 22:25933445-25933467 ACAAAAGGCCTGTGTGGAAGGGG - Intronic
1184017287 22:41795671-41795693 AGTTAGGGCCTGTGTGGAATGGG + Intronic
953660677 3:44889394-44889416 AGAAAGGGCAGGTGTGGAAAAGG - Intronic
954714083 3:52518502-52518524 AGCAACAGCATGAGTGGAATGGG - Intronic
955106533 3:55904165-55904187 AGAAAGGAACTGTGTGGAATAGG + Intronic
956809113 3:72847399-72847421 AGCAGCGGGTTCTGTGGAATGGG + Intronic
959434929 3:106303054-106303076 AGTAAGGGCATGTGTGGAATAGG - Intergenic
959947174 3:112137569-112137591 AGAAACCGTATGTGTTGAATTGG + Intergenic
965392045 3:168116775-168116797 AGAAAAGTTTTGTGTGGAAAGGG + Intergenic
970007310 4:11424158-11424180 AGTAACAGCTTGAGTGGAACAGG - Intronic
971362221 4:25948907-25948929 AGAAACTGACTGTCTGGAATTGG - Intergenic
973574083 4:52268398-52268420 AGACACAGCTTGGGGGGAATTGG - Intergenic
975552907 4:75631101-75631123 AGAGAGGGCATGAGTGGAATGGG + Intergenic
977346690 4:95824777-95824799 AGAAAAGGGTGGTGTGGAACTGG + Intergenic
979793570 4:124816208-124816230 AGAAAAGTCTTCTCTGGAATTGG - Intergenic
979828510 4:125270518-125270540 AGAATCAGCTTTTGTGGTATAGG + Intergenic
980345729 4:131615423-131615445 TGAAAGTGTTTGTGTGGAATTGG + Intergenic
982763293 4:159314997-159315019 AGAAAGGGTTTATGTGGAAAGGG - Intronic
983039101 4:162903206-162903228 AGAAAAGGTTGGTGTGGAAAAGG - Intergenic
983588959 4:169386401-169386423 TGGAACAGCTTGTGTGGAATTGG + Intergenic
984130217 4:175865867-175865889 AAAAACAGTTTGTGTGGAACTGG + Intronic
991626222 5:68603771-68603793 AGGAACAGCTTTTGTGGAACTGG - Intergenic
992958777 5:81938268-81938290 AGGACAGGCTTGGGTGGAATGGG - Intergenic
995293615 5:110490450-110490472 TGAAAAGGTTTGTGTGGAATAGG - Intronic
996117837 5:119637653-119637675 TGAAAGAGCTTCTGTGGAATGGG + Intergenic
998425931 5:142028658-142028680 AGAAACAGCCTGGGTGGAAATGG + Intergenic
999519104 5:152332121-152332143 AGAAGCTGCTTGTGTGGAGGGGG + Intergenic
1004506702 6:16252778-16252800 AGAGTGGGCTTGTGTGGATTGGG + Intronic
1009816771 6:68747265-68747287 AGAATAGGCTTGTGTGTAAGCGG + Intronic
1014538548 6:122647090-122647112 AGAAACTTATTGTGAGGAATGGG + Intronic
1016207608 6:141488663-141488685 AGAAACGGCTTAAGTGGAGAAGG + Intergenic
1018305866 6:162454656-162454678 AGGAACGGTGTGTGAGGAATAGG - Intronic
1019999485 7:4747194-4747216 ACAAGCGGCTTGTGTGGAGTAGG + Intronic
1021877937 7:25065840-25065862 TGAAATGGCTTCTGTGGAATCGG - Intergenic
1021954801 7:25813558-25813580 AGATATGGTTTGTATGGAATGGG + Intergenic
1022203190 7:28137667-28137689 AGAAACGGCATCTGTGGAGAGGG - Intronic
1027163467 7:75818677-75818699 AGAAACAGCATGTGTGGAGGAGG + Intronic
1029921243 7:104266633-104266655 AAGATCTGCTTGTGTGGAATAGG - Intergenic
1034982854 7:155489715-155489737 AGACAAGTCTTGTGTGGATTGGG + Intronic
1038241875 8:25817541-25817563 AGAAATGGCTGGTGGGGAGTTGG + Intergenic
1039651911 8:39351072-39351094 AGAACCGACCTGTGAGGAATTGG + Intergenic
1040755688 8:50771568-50771590 AGAAAAGGCATGTTTGGAAAGGG + Intronic
1043649438 8:82571822-82571844 AGAAAGAGCTTGAGTAGAATAGG - Intergenic
1045766741 8:105681318-105681340 TGAAAGGGGTTGTGAGGAATGGG - Intronic
1047112564 8:121807083-121807105 AGAAGTGGCTTGTGTGCCATGGG - Intergenic
1048747484 8:137631091-137631113 AGAAAAGGGTTGAGTGGAAGTGG - Intergenic
1048801586 8:138198990-138199012 AGAAACGCCAGGTGAGGAATTGG + Intronic
1058849973 9:109002213-109002235 AGACACCACTTGTGAGGAATGGG - Intronic
1060326478 9:122620987-122621009 AGAAATATCTTGTGTGGAGTGGG + Intergenic
1188137336 X:26505329-26505351 ACAAATGGCTTGTTTGGATTAGG + Intergenic
1189858707 X:45250344-45250366 AATAAAGGCTTGTGTGGTATTGG - Intergenic
1192151125 X:68713072-68713094 AGACACTGCTTGTGTGTAGTTGG - Intronic
1193577227 X:83214430-83214452 TGAAGTGGCTTGTGGGGAATGGG + Intergenic
1195443899 X:104928763-104928785 AAGAAAGGCTTGTGTTGAATTGG + Intronic
1197821846 X:130549270-130549292 TGAAATGGCTTCTGTGGAATAGG + Intergenic
1200943169 Y:8806118-8806140 AGATACTGCTTTTGTAGAATTGG - Intergenic