ID: 1175353147

View in Genome Browser
Species Human (GRCh38)
Location 20:58340643-58340665
Sequence TTTAAGTTCTTTGAGTGTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 336}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175353147_1175353152 8 Left 1175353147 20:58340643-58340665 CCCCTACACTCAAAGAACTTAAA 0: 1
1: 0
2: 2
3: 16
4: 336
Right 1175353152 20:58340674-58340696 GGGTAAGTCAGACATTGAACAGG 0: 1
1: 0
2: 0
3: 5
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175353147 Original CRISPR TTTAAGTTCTTTGAGTGTAG GGG (reversed) Intronic
900906044 1:5558497-5558519 TTTAAGTTTTGTTAGTGTTGAGG - Intergenic
902038800 1:13477211-13477233 TTTAAACTCTCTGAGAGTAGAGG - Intronic
903614871 1:24643984-24644006 TTAAGGTTCTGTGAGGGTAGAGG + Intronic
904300780 1:29552034-29552056 TGTGAGTTCCTTGAGGGTAGAGG - Intergenic
904457424 1:30656009-30656031 TGTGAGTTCCTTGAGGGTAGGGG + Intergenic
904916911 1:33976899-33976921 TTTAGGTTCTTCAAGTGTCGTGG + Intronic
904922972 1:34023121-34023143 TTTAAATCCTTCGAGTGTGGTGG - Intronic
905342380 1:37288103-37288125 TATGAGTTATTTGAGGGTAGTGG - Intergenic
906247561 1:44287820-44287842 ATTAAGGTCTATGAGTGAAGGGG + Intronic
906747097 1:48229667-48229689 TGTGATTTATTTGAGTGTAGGGG - Intronic
908526659 1:64994283-64994305 ATTAAGTCATTTGAGAGTAGTGG + Intergenic
908698668 1:66873705-66873727 TTTCAGCTCTTTCAGTGTAAGGG + Intronic
910213557 1:84818630-84818652 TTTAAGTTCTTTAAGTTGGGTGG - Intronic
910612449 1:89159481-89159503 TTTAAGTTCTTTGTATATACTGG - Intronic
911444646 1:97976028-97976050 TTTAAATTCTTTAATTGTAAAGG - Intergenic
911991680 1:104706025-104706047 TTTAAGCTCTTTGAAAATAGAGG + Intergenic
912768588 1:112440018-112440040 TTTAAGCTCCTTGAGGGCAGTGG + Intronic
914234510 1:145796233-145796255 TTTGAGCTCTTAGAGTGAAGGGG - Intronic
915638583 1:157203785-157203807 TGTAAGTTCCTTGAGGGCAGGGG + Intergenic
915691110 1:157691828-157691850 TTCAAGTTCTTTGATTTTAGGGG - Intronic
915735624 1:158083071-158083093 TGTAAGTTCCCTGAGGGTAGCGG - Intronic
918793524 1:188861002-188861024 TTTAAGAGTTTTGAGTGTATAGG + Intergenic
919087508 1:192937991-192938013 TTTAAATTAGCTGAGTGTAGTGG + Intergenic
919181304 1:194085667-194085689 TGTGAGTTCTTTGAGGGCAGAGG + Intergenic
920809240 1:209266613-209266635 TTTAAGTTCATCTAGTCTAGTGG + Intergenic
922813207 1:228429852-228429874 TTAAAGTTCTTTGAGATTTGGGG + Intergenic
924552529 1:245091801-245091823 TTGAAGTGATTTGAGTGTAAAGG - Intronic
1063460558 10:6212665-6212687 TTTAATTTATTTGTTTGTAGAGG + Intronic
1064038596 10:11937325-11937347 TATGAGCTCTTTGAGTGTAGAGG - Intronic
1064720956 10:18228018-18228040 TTTACATTCTTTCAGGGTAGGGG + Intronic
1065301445 10:24325205-24325227 TGCAAGTTCTTTGACAGTAGTGG + Intronic
1065815090 10:29475898-29475920 TTTAAGTTCTTAAAAGGTAGGGG + Intronic
1066361051 10:34731576-34731598 TTTAAGTTCTGTGATTTTAATGG - Intronic
1066707597 10:38198503-38198525 TTTAAGTTCTCCGGGTGTGGTGG + Intergenic
1066973239 10:42337473-42337495 TTTATGTTCTTTCAGTTTTGAGG + Intergenic
1067524720 10:47031374-47031396 TTTGAGTTCTTGAAATGTAGGGG + Intergenic
1068824157 10:61414466-61414488 TTTAAATGCTTCAAGTGTAGAGG + Intronic
1069312695 10:67058218-67058240 TGTAAGTTGTTGCAGTGTAGTGG - Intronic
1070384410 10:75911753-75911775 TTTAAGCTCTTTGAAGGCAGGGG - Intronic
1071026371 10:81118895-81118917 TTTATGTTTCTTGAGTGAAGGGG - Intergenic
1071158378 10:82717739-82717761 TTTAAGTAATCTGAGTGTACAGG + Intronic
1072026951 10:91468781-91468803 TTTAAGTTAGCTGGGTGTAGTGG + Intronic
1072185909 10:93038801-93038823 TTTGAGTTCTTCAAGGGTAGAGG - Intronic
1073496492 10:103896266-103896288 TTTAAGTTCTGTGAGAGCAGAGG - Intronic
1073853950 10:107653966-107653988 TTTAAGTTTCTTGTGTGCAGAGG - Intergenic
1074094470 10:110297966-110297988 TTTAATGTCTTTGAGAATAGAGG + Intronic
1074477177 10:113784110-113784132 TTTTATTTCTTTCATTGTAGTGG - Intergenic
1074479794 10:113809010-113809032 TTGAACTTGTTTGAATGTAGTGG - Intergenic
1075803053 10:125164620-125164642 TTAGAGGTCTTTGATTGTAGCGG - Intergenic
1076303248 10:129443958-129443980 TTTAATATTTTTGAATGTAGAGG + Intergenic
1076771462 10:132668097-132668119 ATTCAGTTTTTTGAGTGTACTGG + Intronic
1078631006 11:13004422-13004444 TTGAAGTTCTGTGAGGGCAGAGG - Intergenic
1080706201 11:34696756-34696778 TTTGATTTCTTTATGTGTAGTGG + Intergenic
1080967424 11:37229456-37229478 GTTAGGTTTGTTGAGTGTAGAGG + Intergenic
1081282485 11:41226811-41226833 TTTAAGTAGTTTGATTGTGGAGG - Intronic
1081955970 11:47093542-47093564 AGTAAGTTTTTTGAGGGTAGGGG + Intronic
1086016755 11:82177325-82177347 TGTCAGTTCTTTGAGATTAGAGG - Intergenic
1086943699 11:92823964-92823986 TTTAAGCTGTTTCATTGTAGTGG + Intronic
1087170629 11:95046398-95046420 TCTAAGTTCTATGATTGCAGGGG - Intergenic
1087618888 11:100520052-100520074 TTTAAGTTCTGTAATTCTAGAGG + Intergenic
1088036667 11:105325529-105325551 TTTAAGTTCATTGAGTTCTGAGG - Intergenic
1088628862 11:111754395-111754417 TTAAAGCTCTTTGAGTTTAAAGG - Intronic
1089241149 11:117081321-117081343 TTTAAAGTCTTTGAGGCTAGAGG + Intronic
1090336745 11:125973668-125973690 TTTAAGTTCTTTGAGGATTCAGG + Intronic
1091863340 12:3806567-3806589 TTTAAGTTCCATGAGAGCAGAGG + Intronic
1092532197 12:9353860-9353882 TTAAAGTTCTTTCAGCGAAGTGG - Intergenic
1092813539 12:12293066-12293088 TTTAAGTCTTTGGAGTGCAGTGG - Intergenic
1093133357 12:15418898-15418920 TTTAATTTTTATGTGTGTAGAGG - Intronic
1093476653 12:19562739-19562761 TTTAATATATTTGAGTGTTGTGG + Intronic
1093796181 12:23315063-23315085 ATTAAGGGCTTTGAGAGTAGGGG - Intergenic
1093961929 12:25283450-25283472 TTCAAGTTCTTTTTTTGTAGTGG + Intergenic
1095136967 12:38616319-38616341 TTTAAGTTCTTTAAGTTTTAGGG + Intergenic
1096142570 12:49254575-49254597 CTTCTGTCCTTTGAGTGTAGTGG + Intronic
1097994215 12:65870143-65870165 TTTAAGACCTTTCAGTCTAGGGG + Intronic
1098672573 12:73249335-73249357 TATAAGTTCTATGAGGGCAGGGG + Intergenic
1098679474 12:73333322-73333344 TTTAACTTCTTTTAGTTGAGTGG + Intergenic
1099352214 12:81587800-81587822 TCTAAGATCCTTGAGTGCAGAGG + Intronic
1100007778 12:89914465-89914487 TATAAGCTATTTGAGGGTAGAGG + Intergenic
1104732876 12:131118208-131118230 TAAAAGTTCTTTGAGGATAGGGG + Intronic
1106304574 13:28498214-28498236 TTTAAGTTCTTTGAAAATGGGGG - Intergenic
1106454286 13:29913150-29913172 TTTAAGCATTTTGAGTTTAGTGG + Intergenic
1108967642 13:56330268-56330290 TTTAAGCTCTTTGAGAGTAAGGG - Intergenic
1109052118 13:57496182-57496204 TGAAAGCTCTTTGAGGGTAGGGG + Intergenic
1111142322 13:84135710-84135732 TTTTAGTTTTTTGTGTGTAGGGG + Intergenic
1111705818 13:91748422-91748444 TTAAAGTTCTTTAAGTGCACAGG - Intronic
1112679382 13:101744902-101744924 TATAAGGTCTTTGAGGGCAGGGG - Intronic
1112828180 13:103416553-103416575 TTTAAATTCTTTGACATTAGAGG + Intergenic
1112958835 13:105096415-105096437 TTTAAATACTTTGTTTGTAGAGG - Intergenic
1114013142 14:18396174-18396196 TTTATGTTCTTTCAGTTTTGAGG + Intergenic
1114511136 14:23262076-23262098 TGTAACTTCTATGAATGTAGGGG - Intronic
1116561862 14:46389989-46390011 TTTAAGGACTTAGAGTGTAAGGG + Intergenic
1117156164 14:52944115-52944137 TTTAAGTTCTTTAAAAGTGGAGG - Intronic
1117485011 14:56187447-56187469 TTTAAGTAGTTTGGTTGTAGGGG + Intronic
1118092976 14:62503059-62503081 TTGAATTTCTCTGAGTATAGAGG + Intergenic
1118335345 14:64848939-64848961 TCAAAGCTCTGTGAGTGTAGGGG - Intronic
1118820603 14:69342989-69343011 TGTAAGTTCTATGAGGGTGGAGG + Intronic
1118858333 14:69641740-69641762 TTTAAATTATCTGGGTGTAGTGG - Intronic
1119573076 14:75693505-75693527 TCTCAGTAATTTGAGTGTAGTGG + Intronic
1120468506 14:84892862-84892884 TGTGAGTTCTTTGAATGCAGAGG + Intergenic
1120480149 14:85039063-85039085 TTTTTGTTTTTTGATTGTAGTGG - Intergenic
1121366864 14:93320798-93320820 TGTAATTTCTCTGTGTGTAGAGG - Intronic
1121447024 14:93985363-93985385 TTTACATTCTTTAAGTGAAGAGG + Intergenic
1121898760 14:97673051-97673073 TTGAACTTCTTTTACTGTAGCGG - Intergenic
1123841064 15:24247583-24247605 TTTAATTTTTTTTAGTGGAGAGG + Intergenic
1125568824 15:40698591-40698613 TTTATATTCCTTCAGTGTAGGGG - Intronic
1128674886 15:69601232-69601254 TTTCAGTTCCTTGAGGGCAGAGG + Intergenic
1129293759 15:74588088-74588110 TTTAAATTCCCTGAGTGTGGTGG + Intronic
1129379284 15:75155134-75155156 TTTCAGTTCCTTGAGGGTGGAGG - Intergenic
1130624502 15:85499864-85499886 ATTATGTTCCTTGAGGGTAGGGG + Intronic
1130753225 15:86735401-86735423 TTTAAGTTGTGTGTGTGTAATGG - Intronic
1131705154 15:94985428-94985450 TTTTTTTTTTTTGAGTGTAGTGG - Intergenic
1132501496 16:286464-286486 GTCAAGTTCTGTGAGTGTTGAGG + Exonic
1135390522 16:22089489-22089511 TTTAAGTGCTTTGGGAGTAGGGG - Intergenic
1135855671 16:26007857-26007879 TTTATGTCCTTGGATTGTAGGGG - Intronic
1136471389 16:30483117-30483139 TTTAATTTTTTTGAGGGTGGAGG + Intronic
1139788536 16:69413566-69413588 TTTAAGTTAGCTGAGTGTGGTGG - Intergenic
1140505988 16:75473110-75473132 TTTCAGTCATTTGAGTGTTGTGG - Exonic
1141375036 16:83522833-83522855 TTTAAGTCCTTGGGGTGGAGGGG - Intronic
1143144988 17:4769225-4769247 TTTAAATTAGTTGAGTGTGGTGG + Intergenic
1144382210 17:14712153-14712175 TTGAAGTTCTTTGAGTGCCTTGG - Intergenic
1146823720 17:36005733-36005755 TTAATGTTCTTTAAGTTTAGAGG + Intergenic
1147516694 17:41124549-41124571 TTTAACCTCTTTGAGAGCAGAGG - Intergenic
1147973173 17:44231048-44231070 TTTTACTTGTTTGAATGTAGAGG + Intergenic
1148090480 17:45020063-45020085 TTCCAGTCCTTTGAGGGTAGAGG + Intergenic
1149521607 17:57322110-57322132 TTTAAGCTCCATGAGGGTAGGGG + Intronic
1149945896 17:60926565-60926587 TTGAAATTCTGTGAGTGTTGTGG + Intronic
1150880545 17:69020953-69020975 TTTATGTTCTTGAAGGGTAGAGG - Intronic
1152039033 17:77891338-77891360 TTAAAGTTATCTGAGTGTGGTGG - Intergenic
1153390534 18:4552705-4552727 GTTCAGTACTTTGAGTGTGGTGG - Intergenic
1154524588 18:15270843-15270865 TTTATGTTCTTTCAGTTTTGAGG - Intergenic
1156135964 18:34038011-34038033 TTTGAGTTCTTTGAGTATTTTGG - Intronic
1156217181 18:35011536-35011558 TTGAAGTCCTTTAAGCGTAGAGG + Intronic
1158501606 18:58007395-58007417 TGTAAGTTCTTTAAGGGAAGAGG + Intergenic
1159779780 18:72647502-72647524 GTTAAAGTCTTTGAGAGTAGGGG + Intergenic
1160094439 18:75858859-75858881 TTTAAGTACATTAAGTGTGGGGG + Intergenic
1166654563 19:44601036-44601058 TTTTAGCTCTATGAGGGTAGGGG - Intergenic
928106907 2:28476486-28476508 TATAAGTTCTTTGAGGTCAGTGG + Intronic
928690458 2:33793560-33793582 TTCAAGTTCATTCAGGGTAGAGG - Intergenic
929944830 2:46362424-46362446 TTTCAGCTCCTTGAGTTTAGTGG - Intronic
930263444 2:49172894-49172916 TTTAACTGCTTTGAGAGAAGGGG + Intergenic
930448743 2:51507928-51507950 TTTAAATTCCTTGAGTGCATAGG - Intergenic
930637348 2:53821029-53821051 TCAAACTTCTTTGAGGGTAGGGG + Intergenic
930857640 2:56036155-56036177 TTTAAGTTCTCTGACAGCAGGGG + Intergenic
931094074 2:58919906-58919928 TGTAAGTGCTGTGAGAGTAGGGG - Intergenic
931478502 2:62615802-62615824 TTTAAGTGATTGGAGTGCAGAGG - Intergenic
933185394 2:79272584-79272606 TTTAATTTCCTTAAGTGTAAAGG - Intronic
933563637 2:83921530-83921552 CTTAAGTTCTTTGTGGATAGTGG + Intergenic
933605187 2:84375263-84375285 TTTAAATTCTTTAAGTATTGAGG - Intergenic
933821208 2:86113803-86113825 TTTAATTTTTTTGTGTGTGGCGG - Intronic
934746968 2:96765627-96765649 TATAAGCTCCTTGAGGGTAGAGG + Intronic
935596380 2:104881308-104881330 TTTTAGTTATGTGAGTGTGGTGG - Intergenic
937402866 2:121600252-121600274 TGTAATTTCTCTAAGTGTAGTGG - Intronic
938523774 2:132102956-132102978 TTTATGTTCTTTCAGTTTTGAGG - Intergenic
938827084 2:135016689-135016711 TTTTACTACTTTCAGTGTAGAGG + Intronic
941645679 2:168038390-168038412 TTTAAGTACTTTTTGTGCAGTGG - Intronic
943086476 2:183317957-183317979 TGTAAATTATTTGAGGGTAGGGG + Intergenic
943225799 2:185173890-185173912 TTTTTGTTCTTTGAGTTTTGTGG + Intergenic
945549498 2:211202571-211202593 TATAAGTTCTTAGAGGGCAGAGG - Intergenic
945665792 2:212740310-212740332 TTTAAAATTTTTCAGTGTAGAGG - Intergenic
946012316 2:216575325-216575347 AGTGAGTTCTTTGAGGGTAGGGG + Intronic
946789614 2:223286805-223286827 TTTAATTTCTTTCAGTGTAGAGG - Intergenic
947711507 2:232318971-232318993 TTCATGTTCCTTGAGTGCAGTGG + Intronic
947921352 2:233877495-233877517 TTTAAATTCTTTGAGTGAGGAGG - Intergenic
948798195 2:240417161-240417183 TTGTAGTTTTTTGAGTGCAGAGG - Intergenic
1169485874 20:6032176-6032198 TTTAAATGCATTGAGTATAGAGG + Intronic
1172333175 20:34090668-34090690 TTTAAGTTCATTAAGTTTAAAGG - Intronic
1172509722 20:35491952-35491974 TGTAAGTTCCTTGAGAGCAGGGG - Intronic
1175353147 20:58340643-58340665 TTTAAGTTCTTTGAGTGTAGGGG - Intronic
1176772856 21:13097643-13097665 TTTATGTTCTTTCAGTTTTGAGG + Intergenic
1177836237 21:26189004-26189026 TTTAAGTTCTTTGAGCAGAAGGG + Intergenic
1179092282 21:38277974-38277996 TAGAAGTTCTTTGAGGGCAGGGG - Intronic
1179199396 21:39202207-39202229 TGTAAGTTCTTTCAGTGTCAAGG + Intronic
1179587104 21:42380383-42380405 TTTAAGTGCTCTGGGTGTGGTGG - Intronic
1180286341 22:10747954-10747976 TTTCATTTCCTTGAGTGTTGTGG + Intergenic
1180437640 22:15326989-15327011 TTTATGTTCTTTCAGTTTTGAGG + Intergenic
1180520494 22:16197360-16197382 TTTATGTTCTTTCAGTTTTGAGG + Intergenic
1182157764 22:28091771-28091793 TTTCAGTTCTGTGAGAGCAGGGG - Intronic
1182943690 22:34302156-34302178 TCTAAGTTCTTTGAGAGTAGGGG + Intergenic
1182952168 22:34387228-34387250 TTTAAGTTCTTTGTGTATTCTGG + Intergenic
1183542750 22:38439089-38439111 TTTAAGTTAGCTGAGTGTGGTGG + Intronic
950241457 3:11373668-11373690 TTTAACTTCTTTGGGAGTTGCGG + Intronic
951889816 3:27558022-27558044 TTTAATTTCTTTGGATGAAGTGG - Intergenic
952876181 3:37946421-37946443 TTTATGTTTTTTAAGTGTAAAGG + Intronic
954011549 3:47644311-47644333 TTTAATTTTTTTCTGTGTAGAGG - Intronic
954189349 3:48945620-48945642 TTTAAGTTCTTTGTGGTCAGGGG + Intronic
954528669 3:51297800-51297822 TTTTAATTAGTTGAGTGTAGTGG + Intronic
954767400 3:52931169-52931191 TGCAAGTTCTTTGAATGTAAAGG - Intronic
954954472 3:54507424-54507446 TTTAGGTTCTCTGAGGGCAGAGG + Intronic
955451219 3:59068691-59068713 TTTAAACTGTTTGAGTGTATTGG + Intergenic
956037383 3:65109440-65109462 TTTAAATTAGTTGAGTGTGGTGG - Intergenic
956106993 3:65829760-65829782 TTTAATATCTTTGAGAGTAATGG - Intronic
957183317 3:76909531-76909553 TTTCAGTTTTTTGAGGGGAGAGG - Intronic
957848552 3:85773734-85773756 TTTAAGTTCCGTGAGTGCTGGGG + Intronic
959675098 3:109025957-109025979 TGTAAGTTCTGTGAGAGCAGGGG - Intronic
963068195 3:141280523-141280545 TTTAAATCCTTTGTGTGAAGAGG + Intronic
963895224 3:150678539-150678561 TTTAAGCGCTTTGAATCTAGTGG + Exonic
964598525 3:158467261-158467283 TGTAAGCTCTTTGAGTATATGGG - Intronic
964914560 3:161824390-161824412 TTGCAGTTCTTTGATTGTAATGG + Intergenic
966112597 3:176420574-176420596 TATAAACTCTTTGAGTATAGGGG - Intergenic
966390246 3:179445074-179445096 TATTAGTTCTTTGAGCATAGAGG + Intronic
967085695 3:186093239-186093261 TTTAATTTCTTTGTGGGAAGGGG + Intronic
967833312 3:193940796-193940818 GTTAATTTCTTAGAGTCTAGAGG - Intergenic
968683629 4:1940298-1940320 TTTTAGTTACTTGAGTGTTGAGG + Intronic
969898571 4:10327635-10327657 TTTTAGTTTTTTGTGTGTATGGG + Intergenic
970328363 4:14952841-14952863 GATGAGTTATTTGAGTGTAGGGG - Intergenic
970461747 4:16281251-16281273 TTTTAGTCTTTTAAGTGTAGGGG - Intergenic
971511243 4:27427287-27427309 TTGAATTTCTTTGACTTTAGTGG + Intergenic
971749254 4:30625051-30625073 TTTAAGTTCTTTGTAGGTTGTGG + Intergenic
971783947 4:31076139-31076161 TTGAAGCTCTTAGAGTGCAGAGG + Intronic
972165653 4:36280980-36281002 TTTACTTTCTTTCAGTGAAGGGG + Intergenic
972841134 4:42931424-42931446 TTTAAGTTTTTTGTTGGTAGGGG + Intronic
975045458 4:69797949-69797971 TTTAAATTCATTGAGAATAGTGG - Intergenic
975338131 4:73205144-73205166 TTTAAATTTTTTTATTGTAGAGG - Intronic
976500819 4:85786995-85787017 TGTAAGCTCTTTGAGGGCAGGGG + Intronic
977310011 4:95374362-95374384 TTTAAGTGCTTTGAGTGTCACGG + Intronic
977739524 4:100461124-100461146 TTTAAGTTGTTTGAATAAAGAGG - Intronic
978084797 4:104637731-104637753 ATTAATTTGTTTGGGTGTAGAGG - Intergenic
979084992 4:116396938-116396960 CCTTAGTTCTTTTAGTGTAGGGG + Intergenic
981432241 4:144674704-144674726 ATTAAATTCTTTGTGTGTGGTGG - Intronic
981723957 4:147828814-147828836 TTACACTTCTTTGAGTGTGGAGG - Intronic
982066039 4:151655338-151655360 TTTGAGTTCATTGAGGGCAGGGG - Intronic
982591173 4:157313536-157313558 TTTAAGGTCTTTCAGGGTAGGGG + Intronic
982748610 4:159132402-159132424 TTTGAGTCCTTTGGTTGTAGAGG + Intronic
982795342 4:159637523-159637545 TTTAAGAACTTTGAGTGTGATGG + Intergenic
983450484 4:167904699-167904721 TTAAAGTCCTTTGAGAGAAGGGG - Intergenic
983470473 4:168148132-168148154 TTTGAGTCCTTTGAGTGAATTGG + Intronic
983701464 4:170600469-170600491 TTTAATTTCTTTAACTGTAGTGG + Intergenic
984300487 4:177911452-177911474 TTGAATTCCTTTGAGTGTATTGG - Intronic
987548300 5:19342829-19342851 TTTAAGATCTTTAATGGTAGTGG + Intergenic
987691618 5:21274398-21274420 ATTAAGTTCATTTAGTGTAAGGG + Intergenic
988620408 5:32817021-32817043 TTTAAGTTTTATTAGTGGAGAGG + Intergenic
989859449 5:46349601-46349623 TTTAAGCTCTTTGAGGCCAGCGG - Intergenic
990527592 5:56643156-56643178 TTTAAGTTATCTGGGTGTGGTGG + Intergenic
990887740 5:60614280-60614302 TTTAATTTCTGTGAGTTTTGGGG + Intronic
990894059 5:60678024-60678046 TTTAAGTTGTTTGAGGGAGGTGG - Intronic
990964292 5:61428513-61428535 TTTAAGTTAGCTGCGTGTAGCGG - Intronic
991024489 5:62015175-62015197 TGTAAGTTCTCTGAGTGCTGGGG - Intergenic
991673145 5:69067503-69067525 TATAACTTTTTTGTGTGTAGTGG - Intergenic
991748759 5:69775739-69775761 ATTAAGTTCATTTAGTGTAAGGG - Intergenic
991800337 5:70355551-70355573 ATTAAGTTCATTTAGTGTAAGGG - Intergenic
991828263 5:70654490-70654512 ATTAAGTTCATTTAGTGTAAGGG + Intergenic
991892695 5:71354991-71355013 ATTAAGTTCATTTAGTGTAAGGG - Intergenic
991956702 5:72001906-72001928 TTTGAGTTCCTTGAAGGTAGAGG + Intergenic
992988761 5:82261617-82261639 TGAAAGCTCTTTGAGGGTAGGGG - Intronic
994178963 5:96743263-96743285 GTTAAGATCTTGGAGTGTGGCGG - Intronic
994193806 5:96899689-96899711 TACAAGTTCTTTGACAGTAGGGG - Intronic
995254285 5:110028753-110028775 TGTAAGCTCTATGAGAGTAGGGG + Intergenic
995311286 5:110715067-110715089 TTTATATTCTTTGAATGAAGGGG - Intronic
995313159 5:110736748-110736770 TTTAGGTTTTTTGAGAGTAGAGG - Intronic
995637991 5:114217870-114217892 TTTAAGTTCTTTGTATGTTTTGG - Intergenic
995639842 5:114243182-114243204 TTTAAGTTCTCAGAGTTAAGAGG + Intergenic
996978976 5:129466790-129466812 TATTACTTCTTTGAGGGTAGAGG + Intronic
998179304 5:139925387-139925409 TGGAAGTTCCTTGAATGTAGAGG - Intronic
998292717 5:140930254-140930276 TTTAATTTCTTTTATTTTAGGGG + Intronic
999477997 5:151919371-151919393 TTTCAGATCTGTGAGTATAGTGG + Intronic
1000398164 5:160797509-160797531 TCTAAGTACTTTGAAAGTAGGGG + Intronic
1000458411 5:161481971-161481993 TTTATCTTCTTTGAATTTAGAGG - Intronic
1000583445 5:163063651-163063673 TTTAAGTTTTTTGTGTATAGAGG + Intergenic
1000585009 5:163086629-163086651 TTTACATTCTTTAAATGTAGGGG + Intergenic
1001391562 5:171383759-171383781 TTAAAATTCGTTGAGTGTGGTGG - Intergenic
1001764614 5:174235579-174235601 TTTAAGTTCTTGAAGTGATGGGG - Intronic
1003865109 6:10355811-10355833 TCTAAGTTCTTGGAGGGCAGGGG - Intergenic
1005685240 6:28247644-28247666 TATAAGTTCTTTGAGGGCAAGGG + Intronic
1005686473 6:28258084-28258106 TTTTAGTACTTTGATTGAAGGGG - Intergenic
1005782865 6:29211477-29211499 TATAAGCTCTGTGAGTTTAGAGG + Intergenic
1006599546 6:35216323-35216345 TCTAAGTTCCTTGAGGGCAGGGG - Intronic
1006952507 6:37835309-37835331 TTTAAGTTAGCTGAGTGTGGTGG - Intronic
1006953581 6:37846152-37846174 TTTAAGCTGTTTGAGGGTTGAGG + Intronic
1007551614 6:42734163-42734185 TTAAAGTTCTTAGAAGGTAGCGG - Intergenic
1008455226 6:51702989-51703011 TTTTAGTGCTTTGAGGGCAGGGG - Intronic
1008490445 6:52081428-52081450 ATTAAGTGCTTTGAGGGCAGGGG - Intronic
1008682200 6:53884517-53884539 TTTAAGATTTTTTTGTGTAGGGG - Intronic
1009161527 6:60288755-60288777 TGTAAGTTCTTTGAGAGTGAGGG + Intergenic
1009974491 6:70658588-70658610 TTTAAATTAGTTGAGTGTGGTGG + Intergenic
1009981559 6:70732129-70732151 TTTAAAATCTTAGAGTGGAGGGG + Intronic
1010111244 6:72236220-72236242 TTTAAGTTCTTCCAATGCAGGGG - Intronic
1010276816 6:73977841-73977863 CTTAAGTTTTTAGAGGGTAGAGG + Intergenic
1010886385 6:81247684-81247706 TCTAAATTATTTGAGTCTAGAGG - Intergenic
1011186150 6:84677745-84677767 TTTAAGTACTCTGAGTGAATAGG - Intergenic
1011365374 6:86575916-86575938 CTTAAGTTCTGTGAGAATAGAGG - Intergenic
1013089415 6:106886373-106886395 TTCAAGCTCTGTGACTGTAGTGG - Intergenic
1013370277 6:109463895-109463917 TTATAGTTCTCTTAGTGTAGAGG + Exonic
1013869558 6:114740832-114740854 TTGAAGTTTTTTCAGGGTAGAGG + Intergenic
1014135618 6:117885476-117885498 TTTCAGTTCTTTGAATGTGGAGG + Intergenic
1014665951 6:124237904-124237926 TGTGATTTCTTTGAGTGGAGGGG + Intronic
1014743719 6:125175133-125175155 TTTAAGCTCCTTGAGGGCAGGGG + Intronic
1017384626 6:153869154-153869176 TTTAAGTTCTTTGTGGGTTCTGG - Intergenic
1018678917 6:166247046-166247068 TTTCAGTTCTTTGAATACAGAGG + Intergenic
1019697494 7:2454089-2454111 TTTAAGTTAGCTGAGTGTGGTGG + Intergenic
1021045134 7:15913409-15913431 TTTAAGTTCTTTAAATATAGGGG + Intergenic
1022770740 7:33470056-33470078 TGTAAGCTCTTCGAGGGTAGAGG + Intronic
1023488131 7:40708908-40708930 TGGAAGTTCCTTGAGGGTAGAGG + Intronic
1024768871 7:52694533-52694555 TTTGAGTGATTTGAGTGCAGGGG + Intergenic
1025120738 7:56299508-56299530 ATTAAGTACTTGGAGTTTAGGGG - Intergenic
1025144135 7:56490363-56490385 CTTAAGCCCTGTGAGTGTAGAGG + Intergenic
1025922375 7:65925560-65925582 TTTAAGCTTCTTGAGGGTAGGGG + Intronic
1026365100 7:69640344-69640366 TTTAAGCTCTGTGAGTGCAGGGG + Intronic
1026440739 7:70441536-70441558 TTTAAGTTATCTGAGTATGGTGG - Intronic
1028059996 7:86300499-86300521 TTTAAATTCTTTTCTTGTAGAGG - Intergenic
1028720242 7:94022480-94022502 TTTCATTTCTGTGAGTGTATTGG + Intergenic
1030853621 7:114522595-114522617 TTTAACTTCTTTGAGGTTACAGG + Intronic
1031343394 7:120633951-120633973 TTAAAGCTCTTTGAGTATAATGG + Intronic
1034919103 7:155064750-155064772 TTTAGGCTCTGTGAGTCTAGAGG - Intergenic
1037010343 8:13834603-13834625 TTTTAGCTCTTGGAGTGAAGTGG + Intergenic
1038457328 8:27685368-27685390 TTTGACTTCTTTGAGTGTTTTGG - Intergenic
1038662002 8:29505685-29505707 TTTAAGTTCTTTGGGTTCCGAGG + Intergenic
1039641940 8:39232932-39232954 GTAAAGTCCTTAGAGTGTAGGGG + Intronic
1040539371 8:48338850-48338872 TTTAACTTCTTTGGGTTTAAGGG + Intergenic
1040767841 8:50937155-50937177 TTTAAGTTCTTTGTGTATTTTGG - Intergenic
1041297476 8:56373629-56373651 TTTTAGTTCCTTGAGGATAGAGG + Intergenic
1042046603 8:64659904-64659926 ATTAACATCTTTGAGTGTATGGG + Intronic
1042437003 8:68777496-68777518 TTTAAGTACTTTAAGTGAAAAGG - Intronic
1043330888 8:79117183-79117205 TTTAAGTTCTTTGTGTATTCTGG - Intergenic
1043415271 8:80041680-80041702 TTTGATTTCTTTGATTTTAGTGG - Intronic
1044132797 8:88546974-88546996 TTGAACTTCTTTGATTTTAGTGG + Intergenic
1044705058 8:95000452-95000474 TTTTGGTTCTATGAGGGTAGAGG - Intronic
1045204487 8:100023882-100023904 TTTAGGTTCCTTGGGTGAAGTGG + Intronic
1046090822 8:109500984-109501006 TTTAGGTTCTATGAGTCTGGAGG - Intronic
1046213871 8:111116636-111116658 TTTATGTACTTTGAGTATTGTGG + Intergenic
1046693203 8:117309129-117309151 TTTAATTACTTTGATTGTGGAGG + Intergenic
1046702333 8:117415210-117415232 TGTAATTTTTTTGAGGGTAGTGG - Intergenic
1049193545 8:141302828-141302850 TGTAAGTTTTTTGAGGGGAGGGG - Intronic
1050177181 9:2880406-2880428 TTTTATTCCTTTGAGGGTAGGGG + Intergenic
1052545838 9:29877376-29877398 TGTAAGTTTTTAGAATGTAGTGG - Intergenic
1053702519 9:40710567-40710589 TTTATGTTCTTTCAGTTTTGAGG - Intergenic
1054412578 9:64834030-64834052 TTTATGTTCTTTCAGTTTTGAGG - Intergenic
1055542852 9:77331569-77331591 TTTAGGCTTTTTGAGTGTGGTGG + Intronic
1055882642 9:81020071-81020093 TGTGAGTTCCTTGAGTGGAGGGG + Intergenic
1057685876 9:97233779-97233801 TTTAAGTTTGCTGAGTGTGGTGG - Intergenic
1058351458 9:104029423-104029445 TATAAGTTCTTTCAGAGTGGAGG - Intergenic
1059500757 9:114751824-114751846 ATTAAGTTCTTTGATTCTAGAGG - Intergenic
1059863892 9:118491828-118491850 TTTATGTTCTTTGAGAGCAAAGG + Intergenic
1187007378 X:15245962-15245984 TTTAAATGCTTTGAGTATACTGG - Intronic
1187538891 X:20170762-20170784 TTAAAATTTTCTGAGTGTAGTGG - Intronic
1187780477 X:22816999-22817021 TTTAGGTTCTTAGAGTATATGGG + Intergenic
1188583600 X:31745619-31745641 TTTATGTTCCTTGTGTGCAGTGG - Intronic
1189128579 X:38474892-38474914 TGAAAACTCTTTGAGTGTAGGGG + Intronic
1190468924 X:50755974-50755996 TTTAAGTTGTTAAAGTGCAGTGG - Intronic
1193850070 X:86526418-86526440 ATTGAGTACTTTGATTGTAGTGG + Intronic
1193925173 X:87475840-87475862 TCTAAGTTGTTTGACTCTAGTGG - Intergenic
1194172780 X:90608309-90608331 TTCAAGTTCTTTGTGGTTAGAGG - Intergenic
1194600623 X:95916725-95916747 TGTAAGATCTTTGAGAGCAGAGG - Intergenic
1195158234 X:102143445-102143467 TTCTAGTTCTTTGGGTTTAGTGG - Intergenic
1195173757 X:102295136-102295158 TTTACGTTCTGTGGGTGTCGAGG - Intergenic
1195185108 X:102391957-102391979 TTTACGTTCTGTGGGTGTCGAGG + Intronic
1195595125 X:106680200-106680222 TTTAAGTTCCATGAGAATAGGGG - Intergenic
1196315520 X:114218053-114218075 ATTAAGTTTTATGAGTTTAGGGG + Intergenic
1196317103 X:114240420-114240442 TTTAGGTGCCCTGAGTGTAGAGG + Intergenic
1196616594 X:117773324-117773346 CTTAGTTTCTTTGAGTGAAGGGG - Intergenic
1197292455 X:124675650-124675672 TGTAAGTTCTGGGAGGGTAGAGG - Intronic
1198453599 X:136792991-136793013 TTTAAATTTTTTGTTTGTAGAGG - Intergenic
1198513364 X:137377203-137377225 TTTTTTTTCTTTGAGTTTAGAGG - Intergenic
1198834436 X:140787038-140787060 TTTAAGTTCTTACAATGTACAGG + Intergenic
1200519007 Y:4186028-4186050 TTCAAGTTCTTTGTGGTTAGAGG - Intergenic
1202628251 Y:56882557-56882579 TTTCATTTCCTTGAGTGTTGTGG - Intergenic