ID: 1175356265

View in Genome Browser
Species Human (GRCh38)
Location 20:58371121-58371143
Sequence CCTCAGATACTGCTGTTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175356262_1175356265 12 Left 1175356262 20:58371086-58371108 CCACATTTTGAGAAATGTGCTTG No data
Right 1175356265 20:58371121-58371143 CCTCAGATACTGCTGTTAGAGGG No data
1175356261_1175356265 19 Left 1175356261 20:58371079-58371101 CCAGAGACCACATTTTGAGAAAT No data
Right 1175356265 20:58371121-58371143 CCTCAGATACTGCTGTTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175356265 Original CRISPR CCTCAGATACTGCTGTTAGA GGG Intergenic
No off target data available for this crispr