ID: 1175356265 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 20:58371121-58371143 |
Sequence | CCTCAGATACTGCTGTTAGA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1175356262_1175356265 | 12 | Left | 1175356262 | 20:58371086-58371108 | CCACATTTTGAGAAATGTGCTTG | No data | ||
Right | 1175356265 | 20:58371121-58371143 | CCTCAGATACTGCTGTTAGAGGG | No data | ||||
1175356261_1175356265 | 19 | Left | 1175356261 | 20:58371079-58371101 | CCAGAGACCACATTTTGAGAAAT | No data | ||
Right | 1175356265 | 20:58371121-58371143 | CCTCAGATACTGCTGTTAGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1175356265 | Original CRISPR | CCTCAGATACTGCTGTTAGA GGG | Intergenic | ||
No off target data available for this crispr |