ID: 1175357476

View in Genome Browser
Species Human (GRCh38)
Location 20:58380335-58380357
Sequence CCGAAGCCGGGTTTTTTTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175357470_1175357476 -2 Left 1175357470 20:58380314-58380336 CCCTTAGGGATAAGCTGAGTCCC No data
Right 1175357476 20:58380335-58380357 CCGAAGCCGGGTTTTTTTTTTGG No data
1175357471_1175357476 -3 Left 1175357471 20:58380315-58380337 CCTTAGGGATAAGCTGAGTCCCG No data
Right 1175357476 20:58380335-58380357 CCGAAGCCGGGTTTTTTTTTTGG No data
1175357467_1175357476 22 Left 1175357467 20:58380290-58380312 CCAAACAGTGAAGGGAAGATTAA No data
Right 1175357476 20:58380335-58380357 CCGAAGCCGGGTTTTTTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175357476 Original CRISPR CCGAAGCCGGGTTTTTTTTT TGG Intergenic
No off target data available for this crispr