ID: 1175365995

View in Genome Browser
Species Human (GRCh38)
Location 20:58456558-58456580
Sequence CACTGCTCTCCCCAAATAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175365995_1175365998 7 Left 1175365995 20:58456558-58456580 CCTCCTATTTGGGGAGAGCAGTG No data
Right 1175365998 20:58456588-58456610 ATGCCTTTCTAGATATATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175365995 Original CRISPR CACTGCTCTCCCCAAATAGG AGG (reversed) Intergenic
No off target data available for this crispr