ID: 1175365998

View in Genome Browser
Species Human (GRCh38)
Location 20:58456588-58456610
Sequence ATGCCTTTCTAGATATATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175365989_1175365998 20 Left 1175365989 20:58456545-58456567 CCAGGCCCTGTGGCCTCCTATTT No data
Right 1175365998 20:58456588-58456610 ATGCCTTTCTAGATATATCCTGG No data
1175365997_1175365998 4 Left 1175365997 20:58456561-58456583 CCTATTTGGGGAGAGCAGTGGTC No data
Right 1175365998 20:58456588-58456610 ATGCCTTTCTAGATATATCCTGG No data
1175365988_1175365998 27 Left 1175365988 20:58456538-58456560 CCTCTTACCAGGCCCTGTGGCCT No data
Right 1175365998 20:58456588-58456610 ATGCCTTTCTAGATATATCCTGG No data
1175365994_1175365998 14 Left 1175365994 20:58456551-58456573 CCTGTGGCCTCCTATTTGGGGAG No data
Right 1175365998 20:58456588-58456610 ATGCCTTTCTAGATATATCCTGG No data
1175365993_1175365998 15 Left 1175365993 20:58456550-58456572 CCCTGTGGCCTCCTATTTGGGGA No data
Right 1175365998 20:58456588-58456610 ATGCCTTTCTAGATATATCCTGG No data
1175365995_1175365998 7 Left 1175365995 20:58456558-58456580 CCTCCTATTTGGGGAGAGCAGTG No data
Right 1175365998 20:58456588-58456610 ATGCCTTTCTAGATATATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175365998 Original CRISPR ATGCCTTTCTAGATATATCC TGG Intergenic
No off target data available for this crispr