ID: 1175366806

View in Genome Browser
Species Human (GRCh38)
Location 20:58461432-58461454
Sequence GCGGCTGGTGGGTCAGCTCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 130}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175366806_1175366822 3 Left 1175366806 20:58461432-58461454 CCCCGAGCTGACCCACCAGCCGC 0: 1
1: 0
2: 1
3: 14
4: 130
Right 1175366822 20:58461458-58461480 GGTGCAGGGGCAGGGCCAGAGGG 0: 1
1: 1
2: 12
3: 153
4: 890
1175366806_1175366814 -10 Left 1175366806 20:58461432-58461454 CCCCGAGCTGACCCACCAGCCGC 0: 1
1: 0
2: 1
3: 14
4: 130
Right 1175366814 20:58461445-58461467 CACCAGCCGCCCAGGTGCAGGGG 0: 1
1: 0
2: 4
3: 45
4: 492
1175366806_1175366816 -6 Left 1175366806 20:58461432-58461454 CCCCGAGCTGACCCACCAGCCGC 0: 1
1: 0
2: 1
3: 14
4: 130
Right 1175366816 20:58461449-58461471 AGCCGCCCAGGTGCAGGGGCAGG 0: 1
1: 0
2: 0
3: 47
4: 405
1175366806_1175366823 4 Left 1175366806 20:58461432-58461454 CCCCGAGCTGACCCACCAGCCGC 0: 1
1: 0
2: 1
3: 14
4: 130
Right 1175366823 20:58461459-58461481 GTGCAGGGGCAGGGCCAGAGGGG 0: 1
1: 1
2: 12
3: 101
4: 908
1175366806_1175366817 -5 Left 1175366806 20:58461432-58461454 CCCCGAGCTGACCCACCAGCCGC 0: 1
1: 0
2: 1
3: 14
4: 130
Right 1175366817 20:58461450-58461472 GCCGCCCAGGTGCAGGGGCAGGG 0: 1
1: 0
2: 1
3: 44
4: 370
1175366806_1175366826 16 Left 1175366806 20:58461432-58461454 CCCCGAGCTGACCCACCAGCCGC 0: 1
1: 0
2: 1
3: 14
4: 130
Right 1175366826 20:58461471-58461493 GGCCAGAGGGGGCGGCAGCACGG 0: 1
1: 0
2: 7
3: 46
4: 493
1175366806_1175366831 24 Left 1175366806 20:58461432-58461454 CCCCGAGCTGACCCACCAGCCGC 0: 1
1: 0
2: 1
3: 14
4: 130
Right 1175366831 20:58461479-58461501 GGGGCGGCAGCACGGGCGGGTGG 0: 1
1: 0
2: 12
3: 3259
4: 3890
1175366806_1175366825 8 Left 1175366806 20:58461432-58461454 CCCCGAGCTGACCCACCAGCCGC 0: 1
1: 0
2: 1
3: 14
4: 130
Right 1175366825 20:58461463-58461485 AGGGGCAGGGCCAGAGGGGGCGG 0: 1
1: 2
2: 24
3: 219
4: 1793
1175366806_1175366829 20 Left 1175366806 20:58461432-58461454 CCCCGAGCTGACCCACCAGCCGC 0: 1
1: 0
2: 1
3: 14
4: 130
Right 1175366829 20:58461475-58461497 AGAGGGGGCGGCAGCACGGGCGG 0: 1
1: 0
2: 2
3: 41
4: 993
1175366806_1175366821 2 Left 1175366806 20:58461432-58461454 CCCCGAGCTGACCCACCAGCCGC 0: 1
1: 0
2: 1
3: 14
4: 130
Right 1175366821 20:58461457-58461479 AGGTGCAGGGGCAGGGCCAGAGG 0: 1
1: 2
2: 127
3: 320
4: 1309
1175366806_1175366827 17 Left 1175366806 20:58461432-58461454 CCCCGAGCTGACCCACCAGCCGC 0: 1
1: 0
2: 1
3: 14
4: 130
Right 1175366827 20:58461472-58461494 GCCAGAGGGGGCGGCAGCACGGG 0: 1
1: 0
2: 3
3: 32
4: 362
1175366806_1175366830 21 Left 1175366806 20:58461432-58461454 CCCCGAGCTGACCCACCAGCCGC 0: 1
1: 0
2: 1
3: 14
4: 130
Right 1175366830 20:58461476-58461498 GAGGGGGCGGCAGCACGGGCGGG 0: 1
1: 0
2: 4
3: 97
4: 4798
1175366806_1175366824 5 Left 1175366806 20:58461432-58461454 CCCCGAGCTGACCCACCAGCCGC 0: 1
1: 0
2: 1
3: 14
4: 130
Right 1175366824 20:58461460-58461482 TGCAGGGGCAGGGCCAGAGGGGG 0: 1
1: 1
2: 13
3: 131
4: 1085

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175366806 Original CRISPR GCGGCTGGTGGGTCAGCTCG GGG (reversed) Exonic
901087800 1:6622217-6622239 TGGGCTGGCGGGTCAGCTGGTGG + Exonic
901212564 1:7534752-7534774 GCTGCTGCTGGGTCAGTTTGGGG + Intronic
905308163 1:37033222-37033244 GCGGCTGGCGGGGCTGCGCGCGG - Intronic
913528099 1:119712728-119712750 GTGGCTGCTGGGGCAGCTGGAGG + Intronic
914004146 1:143717813-143717835 GTGGCTCGTGGGTCCTCTCGCGG + Intergenic
914095375 1:144540165-144540187 GTGGCTCGTGGGTCCCCTCGCGG + Intergenic
914303151 1:146393731-146393753 GTGGCTCGTGGGTCCCCTCGCGG - Intergenic
915247988 1:154569487-154569509 GCGGCTGGTGGAGCATCTCCTGG + Exonic
918479817 1:184966406-184966428 GCATCTGGTGGATCAGCTGGTGG - Intronic
919780734 1:201219130-201219152 GGGGCAGGTGGGCCAGCTTGGGG - Intronic
920032917 1:203048265-203048287 GCAGCTGGAGGGACAGCTGGAGG + Intronic
1064067451 10:12194866-12194888 GCGGCTGGTTGGTAGGCCCGGGG + Intronic
1064479278 10:15723103-15723125 GAGGCTGGTGGATCATCTTGAGG + Intergenic
1065655459 10:27944236-27944258 GCGGGTGGTGAGGCAGCACGGGG - Exonic
1067248039 10:44562545-44562567 GCTGCTGGAGGCTCAGCTCAGGG + Intergenic
1072123038 10:92420658-92420680 GCGGCTGGAGCGCGAGCTCGGGG + Intergenic
1073586712 10:104717452-104717474 GCGCCTTGTGGGTGAGCTCTAGG - Intronic
1075445367 10:122509340-122509362 GCGACTGGAGGGGCAGCTGGTGG + Intronic
1076632747 10:131861250-131861272 GGGGCTGGTGTTGCAGCTCGAGG - Intergenic
1077144359 11:1037960-1037982 GGGGCAGGTGGGGCAGCTCCCGG - Intergenic
1082009004 11:47438005-47438027 GCGGCAGTTGGGACAGCTCCGGG + Exonic
1082807984 11:57462015-57462037 GTGGCTGGTGGGCCAGATGGGGG + Intronic
1084137260 11:67194296-67194318 GCAGCTGCTGGGACAGCTGGGGG - Intronic
1085197648 11:74682137-74682159 GGGGCTGGGGGGCTAGCTCGAGG + Intergenic
1085497702 11:76986831-76986853 GAGGCTGGTGGATCACCTTGAGG + Intronic
1090004150 11:122984994-122985016 GCGGCTGGTGGGTGGGGTGGGGG - Intergenic
1090387582 11:126365707-126365729 CAGGCTGGTGGGGCAGCTGGAGG + Intronic
1103536816 12:121638993-121639015 GCAGCTGGTGTGTCAGCCCTGGG + Intronic
1103885391 12:124196574-124196596 GCAGCTGGTGAGTCAGCTGGGGG + Intronic
1104811737 12:131623593-131623615 GCTGCTGGTCAGTCAGCTCCTGG - Intergenic
1105499782 13:20961690-20961712 GAGGCTGGTGGGTCAGCCCTGGG - Intergenic
1106287205 13:28328458-28328480 GCGGCTGGTGAAGCAGCTCCGGG - Intronic
1106315625 13:28590854-28590876 GGGCCTGATGGGCCAGCTCGAGG - Intergenic
1112427100 13:99312625-99312647 GCAGCTGGTGGCTCTCCTCGTGG - Intronic
1113082756 13:106535273-106535295 GCGGCTGGCGGGTGGGCGCGGGG + Intergenic
1114660169 14:24338783-24338805 GGGGCTGGTGGGGCAGCTGGTGG + Intronic
1115481239 14:33863180-33863202 TCAACTGGTGGGTCAGCTGGGGG - Intergenic
1119756825 14:77125459-77125481 GCGGCCGGCGGGTCAGGTGGAGG + Intronic
1121508946 14:94498016-94498038 GGGTCTTCTGGGTCAGCTCGTGG + Exonic
1121629005 14:95409060-95409082 GCAGCTGGTGAGTTAGCTGGAGG - Intronic
1121640515 14:95481907-95481929 TCGCCTGCTGGGTCAGCACGTGG + Intergenic
1121644160 14:95506522-95506544 GCTGCTGGTGGGTCAGCCCTTGG - Intergenic
1121796660 14:96741627-96741649 GCGGCGTGCGGGCCAGCTCGTGG - Intergenic
1122915571 14:104856846-104856868 GGGGCTGGGGGGTCAGCTGTTGG + Intergenic
1126245388 15:46498917-46498939 GAGGCTGGTGGCTCTGCTCAGGG + Intergenic
1128029793 15:64469795-64469817 GAGGCGGGTGGATCAGCTTGAGG + Intronic
1132656790 16:1044846-1044868 GGGGCTGGCGGCTCCGCTCGGGG - Intergenic
1133970251 16:10562518-10562540 TCAGCTAGTGGGTCAGCTGGGGG - Intronic
1134021107 16:10922269-10922291 GCGGTGGGTGGCTCAGCCCGGGG + Intronic
1135408010 16:22212005-22212027 ACTCCTGGTGGGTCAGCTCAGGG - Intronic
1137603973 16:49775010-49775032 GGGGCTGGTGGGGCAGCTGCTGG - Intronic
1137673206 16:50291325-50291347 GGGGATGGTGGGGCAGCTCTGGG + Intronic
1142680994 17:1548576-1548598 GTGGCTGGTGGGGCACGTCGTGG - Intronic
1143126070 17:4641558-4641580 GTGGCTGGTCGGCCAGCACGGGG - Exonic
1144811700 17:18004473-18004495 GCAGCTGGTGGAGCAGCTGGAGG + Exonic
1144833338 17:18143790-18143812 GTGGCAGGTGGGTCAGCACCAGG + Exonic
1145831698 17:27921425-27921447 GCTGCTGCTGGGGCAGCTAGAGG - Intergenic
1146662571 17:34674465-34674487 GAGGATGGTGGGGCAGCTGGGGG - Intergenic
1151816563 17:76474157-76474179 AAGGCTGGTGGGTCATGTCGGGG + Intronic
1152694806 17:81738759-81738781 TCCGCTGCTGGGTCAGCTCCTGG - Intergenic
1152724768 17:81939750-81939772 GTGGCCAGTGGGTCAGCTCCTGG + Exonic
1152931263 17:83111390-83111412 GCCTCTGAAGGGTCAGCTCGTGG - Intergenic
1153973574 18:10247588-10247610 GCAGCTGGGGTGTCAGCACGGGG + Intergenic
1157605717 18:48924713-48924735 GCTGCTGGTGGGGGAGCTGGAGG - Intronic
1157687038 18:49650960-49650982 GCGGCTGGGGGTTCGGCTGGGGG + Intergenic
1160350199 18:78171871-78171893 GGGGGTGGGGGGTCATCTCGAGG + Intergenic
1160386537 18:78500357-78500379 GGGTCTGGAGGGTCAGCTCGGGG + Intergenic
1160546052 18:79656815-79656837 GAGGCTGGTGGATCTGCTGGTGG + Intergenic
1160605503 18:80046629-80046651 GGGGCTGCTGGGTCGGCACGTGG + Intronic
1162054435 19:8054208-8054230 GGGGCAGGTGGGTCAGGTGGGGG - Intronic
1162740246 19:12769979-12770001 GCGGCAGGTGCGGCAGCTGGAGG - Exonic
1165999157 19:39867497-39867519 TCAGCTGGTGGGTCAGCTGAAGG - Intronic
1166751082 19:45164261-45164283 GAGGCTGGTGGGTGGGGTCGGGG + Intronic
1168710809 19:58498959-58498981 GAGGCTGGAGGGTCAGCTATGGG - Intronic
929857781 2:45650914-45650936 GCGGCGGGCGGGTCAGCCGGGGG - Intergenic
946427770 2:219608501-219608523 GCGGGTGGAGGGCCAGTTCGGGG + Intronic
948717387 2:239874198-239874220 GAGGCAGGTGGGTCAGCAGGAGG - Intergenic
1169252525 20:4071533-4071555 GTGGCTGGTGGGTGGGCTCCTGG + Intronic
1171183925 20:23111494-23111516 GCTGCTGGCAGGTCAGCTCTTGG - Intergenic
1172449271 20:35010329-35010351 GGGGCTGCTGGGTCAGCACCAGG + Intronic
1174523929 20:51156380-51156402 GTGGTTGGTGCCTCAGCTCGGGG + Intergenic
1174528521 20:51192602-51192624 GGGGGTGGTGGGTCGGCTGGAGG - Intergenic
1174582121 20:51579448-51579470 GCAGCTGGCGGGTCACCTGGGGG + Intergenic
1175197387 20:57253659-57253681 GCAGCTGGTGGATGAGCTCATGG + Intronic
1175366806 20:58461432-58461454 GCGGCTGGTGGGTCAGCTCGGGG - Exonic
1175964929 20:62655682-62655704 GCCGCTGCTGGGTCAGCCTGTGG - Intronic
1176375766 21:6086246-6086268 GGGGCCGGTGGGTCAGATGGGGG + Intergenic
1179747708 21:43451998-43452020 GGGGCCGGTGGGTCAGATGGGGG - Intergenic
1180970252 22:19811487-19811509 GTGGCTGGAGGCTCAGCTCTTGG - Intronic
1182442426 22:30372181-30372203 GCTGTTGGTGGGTCGGCTGGAGG + Exonic
1183149843 22:36028747-36028769 GCGGCCGGTGGGCGAGCTCCGGG - Intergenic
1184489827 22:44802135-44802157 GCCGCTGGTGGTCCAGCTCGTGG - Exonic
950101274 3:10358416-10358438 GTGGCTGGCTGGACAGCTCGAGG + Intronic
951023777 3:17809046-17809068 TCAGCTGGTAGGTCAGCTAGGGG + Intronic
952407311 3:33015941-33015963 GCACCTGGTGGGGCATCTCGCGG + Intronic
955095031 3:55788624-55788646 GCAGCTGGTTGGTCAGCTGACGG + Intronic
960993264 3:123325295-123325317 GTGGCTGGTGGGGCAGCCTGTGG - Intronic
961340046 3:126211906-126211928 GGGGCTGGAGGGTCAGCGGGCGG + Intergenic
968582204 4:1400403-1400425 GGGGGTGGTGGGGCAGCCCGAGG + Intergenic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
968943689 4:3652566-3652588 GCAGCTGGTGGGTCAGAGGGAGG + Intergenic
969327114 4:6450495-6450517 CCGCATGGTGGGTCAGCTCGGGG + Intronic
971158341 4:24106808-24106830 CCAGCTGGTGGGTCAGCTGGGGG - Intergenic
982015322 4:151147692-151147714 GAGGCTGGTGGATCAGCTTGAGG - Intronic
987115210 5:14721036-14721058 GTGGGTGGGGGGTCAGCTTGAGG + Intronic
990825410 5:59893314-59893336 GCGGCCGGTGGCCCCGCTCGAGG + Exonic
1000138970 5:158382636-158382658 TCAGCTGGTGAGTCAGCTGGGGG + Intergenic
1000187373 5:158872429-158872451 AAGGCTGGTGGATCAGTTCGCGG - Intronic
1001544398 5:172561729-172561751 CTGGCTGGCGGGTCAGCTGGGGG + Intergenic
1002951870 6:1821362-1821384 GCGGCTGGTGGGTGGGGACGGGG + Intronic
1006650313 6:35545580-35545602 GCAGCAGGTGGGTCAGCCCCAGG + Intergenic
1007478598 6:42135412-42135434 GTGGCGGGTGGGCCAGCTCCGGG + Intronic
1011044368 6:83065793-83065815 GCCGCTGGTTGGTCCGCACGTGG - Exonic
1013224971 6:108114180-108114202 CTGGCTGGTGGGACAGCTGGAGG - Intronic
1013923726 6:115442133-115442155 GTGGGTGGGGGGTCAGCTAGTGG + Intergenic
1014755904 6:125301848-125301870 GCGGCTGGTAGGGCAGCTCAAGG - Exonic
1018794033 6:167172144-167172166 GATGCTGGAGGGTCAGCTCGAGG + Exonic
1018822301 6:167382933-167382955 GATGCTGGAGGGTCAGCTCGAGG - Exonic
1019262176 7:87833-87855 GGGGCAGGTGGGTCACCTGGTGG - Intergenic
1023969238 7:44979056-44979078 GAGGCTGGTGGGGCAGGGCGGGG - Exonic
1025202707 7:56971942-56971964 GCGACTGGTGGATAAACTCGGGG + Intergenic
1025669237 7:63604984-63605006 GCGGCTGGTGGATAAACTCGGGG - Intergenic
1034558853 7:151866970-151866992 GAGGCTGGTGTGGCAGCTCTGGG - Intronic
1035231028 7:157465619-157465641 ACGGCAGCTGGGTCAGCTCAAGG + Intergenic
1035361400 7:158316083-158316105 GCGGCTGGCTGATCACCTCGGGG - Intronic
1037079033 8:14760051-14760073 GCGGGTGGTGGGTTAGTTAGAGG - Intronic
1040323945 8:46331829-46331851 GGGGCTGGTGGGTCAGCTGGCGG - Intergenic
1043031319 8:75136743-75136765 TCAGCTGGTGTGTCAGCTTGTGG - Intergenic
1048618384 8:136104588-136104610 GCCGCTGGTGGCTGAGCCCGAGG + Intergenic
1049397839 8:142409888-142409910 GCTTCTGGTGGCTCAGCTGGAGG - Intergenic
1049619016 8:143589445-143589467 TGGGCTGGTGGGCCAGGTCGGGG + Exonic
1049635241 8:143684643-143684665 GCGGCTGCTGGGACAGACCGGGG + Intronic
1049681684 8:143921519-143921541 GCAGCTTGTGGTGCAGCTCGGGG + Exonic
1049776743 8:144409452-144409474 GCGGCTGGCGGCTCGGCTCCGGG + Intergenic
1049808851 8:144554191-144554213 GGACCTGGTGTGTCAGCTCGTGG + Intronic
1053295045 9:36906691-36906713 GGGGCTGGTGGGAGAGCTTGCGG - Intronic
1056134212 9:83615302-83615324 TCAGCTGTTGGGTCAGCTAGGGG - Intergenic
1056762754 9:89426675-89426697 GGGGCTGGTAGATCAGGTCGAGG - Intronic
1057208301 9:93185817-93185839 GCGGTTTGTGAGTCAGCTGGTGG + Intronic
1061369827 9:130191983-130192005 GCGGCGAGTGGGTCAGGGCGAGG + Intronic
1185578274 X:1190971-1190993 GGGGCTGGTGGGGAAGCTGGAGG + Exonic
1188451182 X:30309246-30309268 GCGGCTGGTGGATCAGTGCTGGG - Exonic
1189071850 X:37872122-37872144 TCAGCTGGTGAGTCAGCTGGTGG + Intronic
1197222587 X:123927991-123928013 TCAGCTGGTGGGTCATCTGGGGG + Intergenic
1199879932 X:151965915-151965937 GAGGCAGGTGGGGCAGGTCGGGG - Intronic
1199979912 X:152915222-152915244 GTGGCTGGTGGGTCAGCCCCAGG + Intronic