ID: 1175367158

View in Genome Browser
Species Human (GRCh38)
Location 20:58463699-58463721
Sequence AGTCCAGGCAGGACAGCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 1, 2: 1, 3: 35, 4: 291}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175367155_1175367158 -1 Left 1175367155 20:58463677-58463699 CCAGAAGGAAACTTAGAGTTGCA 0: 1
1: 0
2: 1
3: 20
4: 210
Right 1175367158 20:58463699-58463721 AGTCCAGGCAGGACAGCCACAGG 0: 1
1: 1
2: 1
3: 35
4: 291
1175367154_1175367158 4 Left 1175367154 20:58463672-58463694 CCATTCCAGAAGGAAACTTAGAG 0: 1
1: 0
2: 2
3: 24
4: 222
Right 1175367158 20:58463699-58463721 AGTCCAGGCAGGACAGCCACAGG 0: 1
1: 1
2: 1
3: 35
4: 291
1175367152_1175367158 14 Left 1175367152 20:58463662-58463684 CCTGCTGTGGCCATTCCAGAAGG 0: 1
1: 0
2: 0
3: 21
4: 234
Right 1175367158 20:58463699-58463721 AGTCCAGGCAGGACAGCCACAGG 0: 1
1: 1
2: 1
3: 35
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175367158 Original CRISPR AGTCCAGGCAGGACAGCCAC AGG Intronic
900031113 1:373795-373817 ATTCCAGGCAGATCCGCCACTGG + Intergenic
900051682 1:602049-602071 ATTCCAGGCAGATCCGCCACTGG + Intergenic
900158297 1:1212211-1212233 GGTCCACGCTGGCCAGCCACAGG + Intronic
900401404 1:2474354-2474376 AGGGCAGGCAGGGCAGCCCCCGG + Intronic
900714094 1:4133106-4133128 AGCCCATGCTGGGCAGCCACTGG - Intergenic
900950043 1:5853413-5853435 AGTCCAGGCAGGACCTCCAGTGG - Intergenic
901144884 1:7058057-7058079 TGTCCAGGCAGGACGGAGACCGG + Intronic
901472698 1:9468592-9468614 AGTCCTTCCAGGTCAGCCACGGG + Intergenic
904682829 1:32240886-32240908 ATTCCAGGGAGGACAGCGTCCGG + Intergenic
905534385 1:38708874-38708896 ATCCCAGGCAGTCCAGCCACAGG - Intergenic
906879918 1:49578343-49578365 AATCCAGGCAGGACTGCAAATGG + Intronic
906930660 1:50166636-50166658 AATCCAGGCAGGACTGCAAATGG - Intronic
907170145 1:52455568-52455590 AGTCCAGCCCGGGCAGCAACAGG + Intronic
907319960 1:53595949-53595971 AGGCCAGGCAGGGCAGCCCATGG + Intronic
911091716 1:94022519-94022541 AGTCCAGGCAGGAGAGGCTAAGG - Intronic
911154084 1:94622450-94622472 AGTCCACGCAGGACAGGAACTGG - Intergenic
911249560 1:95559469-95559491 AGTCCAGGGCAGTCAGCCACAGG - Intergenic
913492256 1:119391920-119391942 AGTCAAGGCAGGAGGGCCTCAGG + Intronic
913609187 1:120493726-120493748 AGCTCAGACAGCACAGCCACAGG + Intergenic
914204643 1:145516723-145516745 AGTTCAGACAGCATAGCCACAGG - Intergenic
914370916 1:147023503-147023525 AGCTCAGACAGCACAGCCACAGG + Intergenic
914582005 1:149028113-149028135 AGCTCAGACAGCACAGCCACAGG - Intronic
915477687 1:156162645-156162667 AGTGTAGGCAGGACAGGCAGGGG + Intronic
915620990 1:157084044-157084066 AGACCAGGCAGGGCAACCACAGG - Intergenic
917046304 1:170864413-170864435 TTTCCAAGCAGGAAAGCCACAGG - Intergenic
917231818 1:172845745-172845767 AGCCCAGGGAGGACAGACAATGG - Intergenic
917512996 1:175683592-175683614 AGCCCAGGCTGGACATCCACAGG + Intronic
919895686 1:202008426-202008448 AGTGCAGGCAGGAGAGCCTGGGG - Exonic
920292201 1:204931038-204931060 GGCCCAGGCAGGACACACACTGG + Intronic
921858294 1:220013125-220013147 AGTCAAGGCAGAAGAGTCACAGG - Intronic
922062727 1:222107553-222107575 GGTCCAGACAGGACACTCACCGG + Intergenic
922887626 1:229032054-229032076 AGCCCAGGCCGGCCAGCCTCTGG - Intergenic
923165834 1:231360769-231360791 TGTCCAGGCAGGACCTCTACTGG - Intergenic
1063513490 10:6670770-6670792 AGGCCAGACAGGACAGTTACTGG + Intergenic
1067661371 10:48238303-48238325 AAGCCAGGCTGCACAGCCACTGG + Intronic
1070111207 10:73488307-73488329 GGCCAAGGCAGGACAGTCACTGG + Intronic
1070789236 10:79179874-79179896 ACTCCAGGCAGGCAGGCCACAGG + Intronic
1071342210 10:84659538-84659560 ATTGCAGGCAGGAAAGCCCCAGG + Intergenic
1073081617 10:100864402-100864424 AGTCCAGTGAGGTCAGCCATAGG + Intergenic
1074531284 10:114300534-114300556 TGTCCAGGCAGGACAACGTCGGG + Exonic
1075686891 10:124370649-124370671 TGGCCAGGCAGGGCAGCCAAGGG + Intergenic
1075714424 10:124547933-124547955 TGTCCAGGCAGGGCAGCCTCTGG + Intronic
1077288513 11:1778205-1778227 AGTCCTTGCAGCAGAGCCACAGG + Intergenic
1079256281 11:18834212-18834234 AGACCAGGCAGGCCCACCACAGG + Intergenic
1079383472 11:19958901-19958923 AGTCCACGCAGCAGAGCCACAGG + Intronic
1079437720 11:20474517-20474539 AGTCCTGGCAGAGCAGCCGCTGG - Intronic
1079444119 11:20544453-20544475 AGGCAAGGCAGGATAGCCAGAGG - Intergenic
1079487045 11:20945980-20946002 AGTCCAGACAGGCCAGCCTCTGG - Intronic
1079492533 11:21005404-21005426 TGTCCAGTCTGAACAGCCACAGG - Intronic
1080843032 11:36002466-36002488 TCTCCAGGCAGGACAGTCACAGG - Intronic
1083144753 11:60749937-60749959 AGTGCAGTCAGAAAAGCCACTGG - Intergenic
1083167266 11:60898368-60898390 CTTCCAGGAAGGACAGCCAGCGG + Intronic
1083213039 11:61201035-61201057 TGTCCAGCCATGAGAGCCACAGG - Intergenic
1083215980 11:61220199-61220221 TGTCCAGCCATGAGAGCCACAGG - Intergenic
1083218864 11:61239025-61239047 TGTCCAGCCATGAGAGCCACAGG - Intergenic
1083404122 11:62444883-62444905 AGTCCAGGCAGCCCAGCCAAGGG + Intronic
1083475526 11:62912694-62912716 GGTCCAGGCAGCTCAGCCAGGGG + Intronic
1084443124 11:69187313-69187335 AGGCCATGCAGGTCAGACACTGG - Intergenic
1084553712 11:69863898-69863920 AGCCACGGCAGGACAGCCTCTGG + Intergenic
1085378392 11:76089033-76089055 AGTCCATGCAGGAAGGTCACTGG - Intronic
1085686918 11:78631762-78631784 TCCCCAGGCAGCACAGCCACAGG - Intergenic
1085929317 11:81062019-81062041 ATTACAGGCATGAGAGCCACTGG + Intergenic
1086908960 11:92450126-92450148 AGTACAGGCAGGTCAGGCAGGGG - Intronic
1087354175 11:97073657-97073679 AGTCCAGCCATGTCAGCCTCAGG + Intergenic
1087374273 11:97322427-97322449 AGTCCAGGCAGGACTACAAATGG + Intergenic
1088097456 11:106117021-106117043 AATCCAGGCAGGACTGCAAATGG + Intergenic
1089254527 11:117187281-117187303 GGTCCAGAGAAGACAGCCACAGG - Intronic
1089322296 11:117634571-117634593 ATTCCAGGCAGCACAGACTCAGG - Intronic
1089625133 11:119746233-119746255 AGTGCAGAGAGGACAGCCCCAGG - Intergenic
1089659751 11:119978211-119978233 AGTCCCGGGAGGAGAGCCCCTGG + Intergenic
1089669130 11:120040262-120040284 AGTAGAGGCAGGACACACACAGG - Intergenic
1090522738 11:127496393-127496415 AGTCCTGGGAGGATGGCCACAGG + Intergenic
1090836228 11:130456003-130456025 AGTCCAGGCAGCACAGCGGCAGG - Intronic
1091836016 12:3586329-3586351 AGACTAGGAAGGAAAGCCACTGG - Intronic
1092218782 12:6699629-6699651 GGTCCAGGCAGGACAGCCAGAGG + Intronic
1094631530 12:32180231-32180253 GGTCCAGGCAGGAAATCCTCTGG - Intronic
1096590073 12:52652151-52652173 TGTCCAGGGAGGAAAGTCACAGG + Exonic
1099400992 12:82203899-82203921 AGTCCAGGCAGGACTACAAGTGG - Intergenic
1099526610 12:83724948-83724970 AATCCAGGCAGGACAACAAATGG + Intergenic
1102167062 12:110815027-110815049 CTCCCAGCCAGGACAGCCACTGG + Intergenic
1102211020 12:111127320-111127342 AGTCCAGGCAGGACTGCTAATGG - Intronic
1103043077 12:117711940-117711962 CCTCCATGCAGGACAGCCAAGGG - Intronic
1103070939 12:117941272-117941294 GGGCCAGGCAGGAAACCCACAGG - Intronic
1103396793 12:120613301-120613323 AATCCAGGCAGGACTGCAAATGG + Intergenic
1104809845 12:131613439-131613461 CGTCCACCCAAGACAGCCACTGG - Intergenic
1105963812 13:25367320-25367342 AGTCCAGGCAGAAAGGCCACAGG + Intergenic
1107014205 13:35695675-35695697 AGGACAGGCAGGCCACCCACGGG - Intergenic
1108360996 13:49667898-49667920 ATGCCAGGCAGGGCAGCCAGGGG + Intronic
1109460294 13:62647131-62647153 AGTCCAGGCAGGACTACTAATGG + Intergenic
1114647664 14:24264487-24264509 CTTCCAGGCAGGTCAGCCAGAGG + Intergenic
1114740337 14:25090430-25090452 TGTCCTGGCAGCACAACCACAGG + Intergenic
1119631696 14:76237606-76237628 AGTCAAGGCATGACAGCCATGGG - Intronic
1119693588 14:76695439-76695461 AGTCCAGGCTGCAGAGCCATGGG + Intergenic
1119731733 14:76955571-76955593 AGTCCTGGGAGGACAGCCTCAGG - Intergenic
1119760779 14:77149657-77149679 AGTCCATGTAACACAGCCACAGG - Intronic
1121950604 14:98167817-98167839 AGTTCCGGCAGGAAGGCCACTGG - Intergenic
1123925844 15:25109843-25109865 AATGCAGGCAGGACACACACAGG - Intergenic
1124141700 15:27082801-27082823 AGACCAGCCAGGACAGCAGCAGG + Intronic
1127045483 15:55020992-55021014 AGTCCAGGCAGGATAGGGAAAGG + Intergenic
1127913374 15:63436467-63436489 AGGCCAGTCAGGACAGCTGCTGG + Intergenic
1128349454 15:66879490-66879512 GCTCCAGGCAGGACACCCAGGGG + Intergenic
1128766743 15:70255719-70255741 AGCCCAGGGAGGACAGCAGCTGG + Intergenic
1129030697 15:72615691-72615713 ACACCAGCCAGGACAGCCAAGGG - Intergenic
1129105631 15:73305439-73305461 AGTCCCTGCAGGGCAGCAACAGG - Intergenic
1129335890 15:74852027-74852049 ATGCCAGGCAGGGCAGCCCCAGG + Intronic
1129477538 15:75796214-75796236 ACACCAGCCAGGACAGCCAAGGG - Intergenic
1129561631 15:76577037-76577059 AGACCAGCCAGGGCAGCCAAGGG + Intronic
1130166933 15:81471004-81471026 AGACCAAGCAGGACATCCACAGG - Intergenic
1130779182 15:87016899-87016921 AGTCCCTGCAGAGCAGCCACTGG + Intronic
1132556821 16:576243-576265 AGTCCACTCACGTCAGCCACAGG - Exonic
1132600894 16:772535-772557 AGTCCAGCCAGGGCAGCCCTGGG + Intronic
1132851067 16:2025304-2025326 TGTCCAGGGAGGCCAGCCACAGG + Intergenic
1133119460 16:3597262-3597284 AGTCCAGGAAGGAAAGGCAGAGG - Intronic
1134629449 16:15746411-15746433 TATCCAGGAAGGACAGCAACAGG + Intronic
1136450648 16:30352705-30352727 AGTCCAGGCAGGGAGGCCACAGG + Exonic
1137620249 16:49871635-49871657 AGTCCAGTGAGGAGAGCCAGAGG - Intergenic
1139340449 16:66264770-66264792 GGCCCGGGCAGGACAGCCAGCGG + Intergenic
1139671746 16:68497090-68497112 AGTCCAGGCCAGACTGCCACTGG + Intergenic
1140486601 16:75298522-75298544 ATTCAAGGCAGCACAGACACAGG + Intronic
1141705435 16:85661958-85661980 CATCGAGGCAGGACAGGCACGGG - Intronic
1142522095 17:512195-512217 AGTCCAGGCAAGACAGCCACAGG + Exonic
1142587941 17:986310-986332 AATCCAGGCAGGACTACCAAGGG - Intergenic
1142602515 17:1061158-1061180 ACCCCAGGCAGCACAGCCAGTGG + Intronic
1142996982 17:3766243-3766265 AGCCCAGCCAGGACAGCCCTGGG - Intronic
1143252378 17:5533068-5533090 GGTCCAGGCAGGCCAGCCTTGGG - Intronic
1143713951 17:8753745-8753767 AGTCCAGGCAGGAGGATCACTGG + Intronic
1144962648 17:19054315-19054337 AGCCCAGGCAGGAGAATCACTGG + Intergenic
1144972513 17:19120206-19120228 AGCCCAGGCAGGAGAATCACTGG - Intergenic
1145241180 17:21241798-21241820 CGTCCAGGCAGGAAGGCCCCTGG + Exonic
1147845669 17:43402442-43402464 AGTCCAGGCTGGAAAGGAACTGG + Intergenic
1148189674 17:45669722-45669744 AGAACAGGGAGGACAGGCACAGG + Intergenic
1148215035 17:45829759-45829781 ATTCCAGGATGGACAGTCACAGG - Intronic
1148371174 17:47100675-47100697 ACTCCAGGCCGGAAAGCCATAGG + Intergenic
1149638626 17:58189478-58189500 GGTCCAGGCTGGAAAGCCCCTGG + Intergenic
1150496577 17:65612399-65612421 AGTGCAGGCAGGAGAGTAACAGG + Intronic
1151656195 17:75497163-75497185 AGCAAAAGCAGGACAGCCACAGG - Exonic
1152514725 17:80816668-80816690 AGGCAAGGCTGGCCAGCCACTGG + Intronic
1152782651 17:82233004-82233026 GCTCCAGGCAGGACAGCCCCAGG + Intronic
1152948528 17:83211874-83211896 ATTCCAGGCAGATCCGCCACTGG - Intergenic
1155560098 18:27066292-27066314 AGTCCAGAGAGGACAGCAACTGG - Intronic
1155982609 18:32196579-32196601 TGTCCAGGAAGCACAGCGACAGG + Intronic
1156377870 18:36531025-36531047 TGTCCAGCCAGGCCAGCCATTGG - Intronic
1158401387 18:57124342-57124364 AGCCCAGGAAGCACAGCCTCTGG - Intergenic
1158477453 18:57792904-57792926 AGCCCTGGCAGGACAGCCTGTGG + Intronic
1159151662 18:64530838-64530860 AATCCAGGCAGGACTGCAAATGG - Intergenic
1160843771 19:1157715-1157737 GGCCCAGACAGGACAACCACTGG + Intronic
1161215977 19:3095199-3095221 GATCCAGACAGGACAGACACAGG - Intronic
1161514373 19:4688644-4688666 AGGCCAGGCAGGCCAGCTCCAGG + Intronic
1162894421 19:13756634-13756656 AGTCCAGGCTGGCCTGCTACAGG - Intronic
1163738300 19:18995296-18995318 AGTCCAGGCATGTGGGCCACAGG + Intronic
1163786815 19:19279064-19279086 ACTCCAGGCCTCACAGCCACAGG + Intronic
1164581434 19:29437817-29437839 AGACCAGGAAGGACAGACTCAGG - Intergenic
1164734507 19:30530960-30530982 AGTGCTGGCAGGACACCCGCAGG - Intronic
1165482565 19:36073411-36073433 TATACACGCAGGACAGCCACTGG - Exonic
1165547803 19:36556389-36556411 ACTCCAGACAGGATAGCCAAGGG + Intronic
1166009066 19:39927685-39927707 TGGCCAGAGAGGACAGCCACGGG + Exonic
1167752031 19:51387299-51387321 TGCCCAGGCAGTACCGCCACAGG + Exonic
1167774185 19:51544176-51544198 AGCGCAGCCAGGACAGACACTGG + Intergenic
925294441 2:2768074-2768096 AGGGCTGGCAGGACAGGCACAGG - Intergenic
928419179 2:31124232-31124254 AGCCCTGGCAGGAGTGCCACTGG - Intronic
928846922 2:35685846-35685868 AATCCAGGCAGTCCAGCCAAAGG + Intergenic
934097916 2:88624690-88624712 GGTGCAGGCAGGACATCCAGAGG - Intronic
935167360 2:100581004-100581026 AGTCCAGAGAGGACAGTCAAGGG - Intergenic
935181266 2:100693058-100693080 ACCCCAGGAAGGGCAGCCACTGG + Intergenic
935348033 2:102126882-102126904 AACCCAGGCTGGACAGCCACTGG - Intronic
936531166 2:113277929-113277951 AGTCCAGCCAGGGGAGTCACTGG + Intronic
936648995 2:114404751-114404773 GTTCCAGACAGGACAGCCTCTGG + Intergenic
936976923 2:118229840-118229862 AGTCCAGGCAGAGAAGCCACTGG - Intergenic
937057539 2:118952243-118952265 AGGCAAGGCAAGACACCCACTGG - Intronic
938960580 2:136336858-136336880 ATTCCAGGCAGGACATGCAAAGG - Intergenic
938964661 2:136377587-136377609 ATTACAGGCATGAGAGCCACTGG + Intergenic
940171062 2:150830839-150830861 AATCCAGGCAGGACTGCAAATGG - Intergenic
943655802 2:190507344-190507366 ATCCCAGCCAGGACAGCCGCTGG - Exonic
946992418 2:225350225-225350247 AGTCCAGGAAGGAAAGAAACAGG + Intergenic
948281827 2:236752924-236752946 AGTCCAGGCAGGAAAGGAAATGG - Intergenic
948423518 2:237874638-237874660 ACTCCAGGCAGGATAGCCTGAGG + Intronic
948694625 2:239726989-239727011 AGGCCAGGCCGGCCAGCCAAGGG - Intergenic
1170431970 20:16284145-16284167 AGTCACACCAGGACAGCCACTGG + Intronic
1171996806 20:31737813-31737835 AATCCAGACAGGAAAACCACAGG - Intergenic
1172114443 20:32565207-32565229 AGCCCAGCCAGGCCAGACACCGG + Intronic
1173499105 20:43539503-43539525 AGACCAGGAAGCAAAGCCACAGG + Intronic
1174040221 20:47694260-47694282 GGGGCAGCCAGGACAGCCACTGG + Intronic
1174252669 20:49231163-49231185 AGTCAGGGCAGGACCGTCACAGG - Intronic
1175260767 20:57672810-57672832 GATCCAGGCAGGACAGCGCCAGG - Intronic
1175367158 20:58463699-58463721 AGTCCAGGCAGGACAGCCACAGG + Intronic
1175813944 20:61873942-61873964 GGTCCCCGCAGGACACCCACAGG + Intronic
1175875555 20:62227722-62227744 AGGCTAGGCAGGCCAGCCAGGGG + Intergenic
1176998418 21:15582116-15582138 AATCCAGGCAGGACTACCAATGG + Intergenic
1178104186 21:29299427-29299449 ATTCCACGCGCGACAGCCACCGG - Exonic
1179906419 21:44425480-44425502 CCCCCAGGGAGGACAGCCACGGG - Intronic
1180118381 21:45726733-45726755 AGACCAGCCAGGCCAGCCATGGG - Intronic
1180708853 22:17826220-17826242 AGGGCAGGCAGGACAGACACAGG - Intronic
1180904224 22:19397204-19397226 AGCCCAGGAAGGGCAGCCATAGG - Intronic
1181023310 22:20114447-20114469 TATCCAGGCAGGTGAGCCACAGG - Intronic
1181580980 22:23827902-23827924 GGGCCAGGCAGGACTGACACTGG - Intronic
1182361483 22:29749047-29749069 AGACAAGGGAGGCCAGCCACAGG - Intronic
1182420628 22:30247002-30247024 AAGCCAGGCAGGAAAACCACAGG - Intergenic
1183429807 22:37758736-37758758 AGTGCAGGCAGGGAGGCCACGGG - Intronic
1184477728 22:44730427-44730449 AGTCCAGGCAGAAAGGCCAAGGG + Intronic
1184667493 22:45996576-45996598 AGTCCAGGGAGGAGAGCTCCAGG + Intergenic
1185056139 22:48579267-48579289 AGGCCTGGCTGGGCAGCCACAGG + Intronic
1185096006 22:48806422-48806444 ATTCCTGCCAGGACAGCCAGGGG + Intronic
951515931 3:23559573-23559595 GCTCACGGCAGGACAGCCACAGG - Intronic
951853040 3:27164252-27164274 TGTGTAGGCAGGACAGCCCCAGG + Intronic
955209265 3:56925807-56925829 AGTGCAGGCACCAAAGCCACAGG + Intronic
960944703 3:122958146-122958168 AGCCCAGGCCTGACAGCCAGGGG + Intronic
961710721 3:128826159-128826181 AATCCAGGCAGGACTGCAAATGG - Intergenic
962344809 3:134611137-134611159 ATTCCCCTCAGGACAGCCACAGG - Intronic
962406397 3:135104141-135104163 AGTCCAGGCAGCACAGGCCTGGG + Intronic
962710584 3:138082271-138082293 GCTGCAGGCAGGACAGCCACAGG + Intronic
963453756 3:145517486-145517508 AATCCAGGCAGGACCGCAAATGG - Intergenic
964292888 3:155201320-155201342 GTTCCAGGCAGGAAAGCAACAGG - Intergenic
965086180 3:164100878-164100900 TTTCCTGGCAGGTCAGCCACTGG - Intergenic
967271965 3:187739751-187739773 AGTCCAGCCAGGACGGCCGAGGG - Intronic
967687669 3:192436614-192436636 TATCCAGGCTGGACAGCCACTGG + Intronic
967973120 3:195013625-195013647 CGTCCAGGGAGGACAGAGACAGG - Intergenic
968461386 4:726919-726941 AGTCCAGGCAAGGCAGGGACTGG - Intronic
968649881 4:1756312-1756334 TGTGGAGGCAGGACAGCCACAGG + Intergenic
968966930 4:3773487-3773509 AGTGTAGGCCGCACAGCCACAGG - Intergenic
969493786 4:7514542-7514564 AGTCATGGCAGGGCAGACACTGG + Intronic
969691041 4:8704333-8704355 AGCCGAGGCAGTACATCCACAGG - Intergenic
970004008 4:11393708-11393730 CCTCCAGGCAGGACAACCTCTGG - Exonic
971878844 4:32341323-32341345 AGTCTAGCCAGGCAAGCCACAGG - Intergenic
973974102 4:56244758-56244780 AGAGCAGACAGGACAGCCACAGG - Intronic
974285702 4:59864653-59864675 ACTCCAGGCAGCACAGCTAAGGG - Intergenic
976442283 4:85089226-85089248 TGTCCAGGCAGGTGTGCCACAGG + Intergenic
978799974 4:112745910-112745932 AGACCAGGAAGGGCAGCCAGTGG - Intergenic
980385548 4:132085192-132085214 AGTCCAGGCAGGACTGCAAATGG - Intergenic
981049379 4:140295502-140295524 AATCCAGGCAGGATAGCTCCTGG + Intronic
982340935 4:154297943-154297965 ATTCCAGCCAGGACAACCACGGG - Exonic
985140237 4:186832271-186832293 CATGCAGGCAAGACAGCCACAGG + Intergenic
985326967 4:188781841-188781863 AGTCCACGCATGACAGCCAGGGG + Intergenic
985497724 5:218807-218829 AGCCCAGCCAGGGCGGCCACCGG - Intronic
988562390 5:32292694-32292716 AGTCCAGGCAGGACTACAAATGG + Intronic
988956381 5:36324202-36324224 AGTCCCAGCAGGACAGGGACAGG - Intergenic
990990570 5:61679359-61679381 TGTCCCTGCAGGACAGACACTGG - Intronic
996400948 5:123061762-123061784 AGTTCAGGGATGACAGCCAAAGG + Intergenic
997197580 5:131990099-131990121 CCTCCTGGTAGGACAGCCACTGG + Exonic
997476503 5:134145562-134145584 ACTCCAGGCAGTAAGGCCACTGG + Intronic
997883535 5:137611509-137611531 AATGCAGGCAGGCCAGCCCCAGG - Intergenic
999315715 5:150582619-150582641 AGTCCAGGAGAGACAGCCATCGG - Intergenic
1001055307 5:168444609-168444631 GGTCCAGGCAGGGCAGCTCCTGG - Intronic
1002488769 5:179559139-179559161 AGTCCTGGCAGGAAAGTCCCAGG - Intronic
1002526487 5:179818566-179818588 AGACCAGCCGGGGCAGCCACAGG - Intronic
1002742707 5:181445073-181445095 ATTCCAGGCAGATCCGCCACTGG - Intergenic
1003093347 6:3122572-3122594 AATTCAGGCAGCACAGACACTGG + Intronic
1003765405 6:9230733-9230755 GGTAAAGGCAGGACAGCCACTGG + Intergenic
1005407936 6:25511719-25511741 AGGCCAGGAAGGATAGACACTGG + Intronic
1006947046 6:37791593-37791615 AGTCCTGGCAGCACTGCAACTGG + Intergenic
1007450781 6:41939497-41939519 AGGCCGGGCAGGAAAGTCACCGG - Intronic
1008625455 6:53311211-53311233 CTACCAGGTAGGACAGCCACAGG - Intronic
1011296077 6:85827457-85827479 AATCCAGGCAGGCCAGTCCCTGG - Intergenic
1011830298 6:91363783-91363805 AATCCAGGCAGGACTGCAAATGG + Intergenic
1012138212 6:95585511-95585533 AGACCAGCCTGGACAACCACGGG - Intronic
1013168670 6:107616825-107616847 AGGCCAGGCAAGACAGCCAAGGG - Intronic
1013773327 6:113651236-113651258 AGCCCAGGCTGGCCTGCCACTGG + Intergenic
1017889168 6:158625016-158625038 ACCACAGGCAGGAAAGCCACAGG - Intronic
1018160544 6:161037885-161037907 AGTCCAGGCAGGACAGAAGCAGG - Intronic
1018826267 6:167409862-167409884 AGGCCGGGCAGAACAGCAACAGG + Intergenic
1019247842 6:170720812-170720834 ATTCCAGGCAGATCCGCCACTGG - Intergenic
1019463794 7:1175385-1175407 AGGCCAGGCAGCCCAGCCGCAGG - Intergenic
1019811070 7:3165488-3165510 AGACCAAGCATGACAGGCACTGG - Intronic
1020127176 7:5539419-5539441 AGGCCAGGCAGGAGAGCGTCAGG - Intronic
1020710576 7:11599232-11599254 AATCCAGGCAGGACTACAACTGG + Intronic
1021153451 7:17180034-17180056 AGACCAGGAAGGAAAGGCACAGG - Intergenic
1022263809 7:28733469-28733491 AGTCTAGGCGGGGCAGCCAGAGG - Intronic
1026741315 7:72980447-72980469 AGGCCAGGCTGGACAGACAAGGG + Intergenic
1026801151 7:73400780-73400802 AGCCCAGGCTGGACAGACAAGGG + Intergenic
1027102419 7:75384631-75384653 AGGCCAGGCTGGACAGACAAGGG - Intergenic
1028360401 7:89960714-89960736 AGTCCAGGCAGGACTACTAATGG - Intergenic
1031947507 7:127857569-127857591 AGTCCAGGCAGGGAGGCCACGGG + Intronic
1032858051 7:135853347-135853369 AATCCAGGCAGGACTGCTAAAGG - Intergenic
1035102700 7:156414687-156414709 AGAGCAGGCAGGACACACACTGG + Intergenic
1035500275 8:87052-87074 ATTCCAGGCAGATCCGCCACTGG + Intergenic
1035909382 8:3548940-3548962 AGTTAAGACAGGACAGGCACAGG - Intronic
1037675470 8:21047343-21047365 AATCCAGGCAGGACTGCAAATGG - Intergenic
1039432941 8:37539754-37539776 AGTCCCTGCAGGAGAGCCAAGGG + Intergenic
1041443306 8:57922810-57922832 AGTCAAGACAGGACCACCACTGG + Intergenic
1042189022 8:66166895-66166917 AGTCAAAGCAGAACAGCCCCTGG - Intronic
1042243251 8:66686027-66686049 GGACCAGGCTGGACAGACACTGG + Intronic
1044717468 8:95113554-95113576 AGTCAATGCAGGAAAGCCTCAGG - Intronic
1047443447 8:124899527-124899549 AGGCAAGGCAAGACACCCACTGG + Intergenic
1049124357 8:140773544-140773566 AGGCCAGGCAGCACACACACAGG + Intronic
1049225158 8:141447090-141447112 AGTCCTCGCAGGAAACCCACTGG + Intergenic
1049232450 8:141491547-141491569 AGTCCTGGCATGACTGCCATGGG + Intergenic
1049619195 8:143590176-143590198 TGCCCAGGGAGGGCAGCCACGGG - Intronic
1049628298 8:143636454-143636476 AGCCCAGGCCGGAGAGCCGCGGG + Intronic
1052956619 9:34257390-34257412 AGTACAGTCAAGACAGCCAGAGG - Exonic
1053611036 9:39713197-39713219 AATCCAGGCAGGACAACTAATGG + Intergenic
1053869078 9:42471219-42471241 AATCCAGGCAGGACAACTAATGG + Intergenic
1054087218 9:60757961-60757983 AATCCAGGCAGGACAACTAATGG - Intergenic
1054242485 9:62629198-62629220 AATCCAGGCAGGACAACTAATGG - Intergenic
1054556609 9:66663716-66663738 AATCCAGGCAGGACAACTAATGG - Intergenic
1055728629 9:79258162-79258184 TGTCCACGCAGCACAGCCCCAGG - Intergenic
1056268289 9:84921589-84921611 AGTGCAGGCAGGAAAGACAAAGG - Intronic
1057825339 9:98368819-98368841 AGCCAAGGCTGGAGAGCCACTGG - Intronic
1058148670 9:101440408-101440430 AGTCCAGGAGCAACAGCCACTGG + Intergenic
1059276696 9:113103721-113103743 AGAGCAGACAGGACAGGCACAGG + Intergenic
1059627042 9:116078614-116078636 AGTCCAAACAAAACAGCCACGGG + Intergenic
1060278430 9:122199541-122199563 AGCCCACGCACGACAGCCCCAGG - Intronic
1060810082 9:126606713-126606735 ATCCTAGGCAGGACACCCACTGG - Intergenic
1061093266 9:128439004-128439026 AGTGCAGGCATGACAGACAGCGG - Intergenic
1061193051 9:129093481-129093503 AGCCCAGGCAGGACAGGGAGGGG - Intergenic
1061281018 9:129597643-129597665 AGTCCCTGCAGGGCAGCGACCGG + Intergenic
1061310048 9:129756124-129756146 AGTCCAAGGAGGACAACCAAAGG - Intergenic
1062070979 9:134554835-134554857 GGCCCAGCCAGGACAGCCAGCGG - Intergenic
1062225514 9:135447372-135447394 CGGCCAGGCAGGACAGGCCCGGG - Intergenic
1062285594 9:135771226-135771248 AGACCAGGCAGGACAGGGGCAGG + Intronic
1062578761 9:137220720-137220742 AGTGCAGGCAGGACAGCACGCGG + Exonic
1203608613 Un_KI270748v1:76292-76314 ATTCCAGGCAGATCCGCCACTGG - Intergenic
1185486525 X:485447-485469 ACACCAGGCAGGAAGGCCACAGG - Intergenic
1186480243 X:9891069-9891091 GGACCAGGAAGGACAGCCGCTGG - Exonic
1187079935 X:15975336-15975358 ATTCCAGGCCGGACTTCCACAGG + Intergenic
1188670418 X:32875321-32875343 AGACTAGGCAGGACAGGCACTGG - Intronic
1189439141 X:41018830-41018852 TCTCCAGGCAGGCCAGCCTCTGG - Intergenic
1190259035 X:48786563-48786585 AGGCCAGCCAGGACACCCCCTGG + Exonic
1190457446 X:50639890-50639912 AGGCCAGGAAGTATAGCCACAGG + Intronic
1193053746 X:77127620-77127642 AATCCAGGCAGGACTGCAAATGG + Intergenic
1193447414 X:81620623-81620645 AGTCCAGGCAGGACTACAAATGG + Intergenic
1195636211 X:107118561-107118583 AGTTCAGGAAGGGCTGCCACCGG - Intronic
1197386537 X:125810375-125810397 AATCCAGGCAAGACAGCAAATGG - Intergenic
1198327002 X:135583986-135584008 AAGCCAGACAGCACAGCCACAGG + Intergenic
1198465654 X:136902520-136902542 AGTCAAGGCAGGAAACCCAAGGG + Intergenic
1198833802 X:140779930-140779952 AGTCCTGGCAGTACAACCCCTGG + Intergenic
1199622752 X:149714315-149714337 AGTCAAGGAAGGACAGGCCCTGG + Intronic
1200062270 X:153488890-153488912 GGGCCAGGCAGGCCACCCACAGG + Intronic
1200214986 X:154364243-154364265 AGTCCAGGTAGAGCACCCACGGG - Exonic
1200658975 Y:5938552-5938574 TTCCCAGGCAGGACCGCCACAGG - Intergenic
1200658984 Y:5938592-5938614 TTCCCAGGCAGGACCGCCACAGG - Intergenic