ID: 1175367757

View in Genome Browser
Species Human (GRCh38)
Location 20:58467370-58467392
Sequence CGCGCAGTCCCGGCCGGCGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 178}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175367744_1175367757 13 Left 1175367744 20:58467334-58467356 CCCAGGCAGCCAGGCCCGGGCCG 0: 1
1: 0
2: 2
3: 32
4: 329
Right 1175367757 20:58467370-58467392 CGCGCAGTCCCGGCCGGCGCGGG 0: 1
1: 0
2: 1
3: 18
4: 178
1175367748_1175367757 4 Left 1175367748 20:58467343-58467365 CCAGGCCCGGGCCGGAGGCAGCC 0: 1
1: 0
2: 1
3: 52
4: 427
Right 1175367757 20:58467370-58467392 CGCGCAGTCCCGGCCGGCGCGGG 0: 1
1: 0
2: 1
3: 18
4: 178
1175367745_1175367757 12 Left 1175367745 20:58467335-58467357 CCAGGCAGCCAGGCCCGGGCCGG 0: 1
1: 0
2: 8
3: 46
4: 502
Right 1175367757 20:58467370-58467392 CGCGCAGTCCCGGCCGGCGCGGG 0: 1
1: 0
2: 1
3: 18
4: 178
1175367750_1175367757 -2 Left 1175367750 20:58467349-58467371 CCGGGCCGGAGGCAGCCGCCGCG 0: 1
1: 0
2: 1
3: 26
4: 292
Right 1175367757 20:58467370-58467392 CGCGCAGTCCCGGCCGGCGCGGG 0: 1
1: 0
2: 1
3: 18
4: 178
1175367743_1175367757 14 Left 1175367743 20:58467333-58467355 CCCCAGGCAGCCAGGCCCGGGCC 0: 1
1: 1
2: 7
3: 73
4: 652
Right 1175367757 20:58467370-58467392 CGCGCAGTCCCGGCCGGCGCGGG 0: 1
1: 0
2: 1
3: 18
4: 178
1175367751_1175367757 -7 Left 1175367751 20:58467354-58467376 CCGGAGGCAGCCGCCGCGCGCAG 0: 1
1: 0
2: 0
3: 14
4: 169
Right 1175367757 20:58467370-58467392 CGCGCAGTCCCGGCCGGCGCGGG 0: 1
1: 0
2: 1
3: 18
4: 178
1175367749_1175367757 -1 Left 1175367749 20:58467348-58467370 CCCGGGCCGGAGGCAGCCGCCGC 0: 1
1: 0
2: 3
3: 51
4: 366
Right 1175367757 20:58467370-58467392 CGCGCAGTCCCGGCCGGCGCGGG 0: 1
1: 0
2: 1
3: 18
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175367757 Original CRISPR CGCGCAGTCCCGGCCGGCGC GGG Exonic