ID: 1175367757

View in Genome Browser
Species Human (GRCh38)
Location 20:58467370-58467392
Sequence CGCGCAGTCCCGGCCGGCGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 178}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175367750_1175367757 -2 Left 1175367750 20:58467349-58467371 CCGGGCCGGAGGCAGCCGCCGCG 0: 1
1: 0
2: 1
3: 26
4: 292
Right 1175367757 20:58467370-58467392 CGCGCAGTCCCGGCCGGCGCGGG 0: 1
1: 0
2: 1
3: 18
4: 178
1175367751_1175367757 -7 Left 1175367751 20:58467354-58467376 CCGGAGGCAGCCGCCGCGCGCAG 0: 1
1: 0
2: 0
3: 14
4: 169
Right 1175367757 20:58467370-58467392 CGCGCAGTCCCGGCCGGCGCGGG 0: 1
1: 0
2: 1
3: 18
4: 178
1175367744_1175367757 13 Left 1175367744 20:58467334-58467356 CCCAGGCAGCCAGGCCCGGGCCG 0: 1
1: 0
2: 2
3: 32
4: 329
Right 1175367757 20:58467370-58467392 CGCGCAGTCCCGGCCGGCGCGGG 0: 1
1: 0
2: 1
3: 18
4: 178
1175367743_1175367757 14 Left 1175367743 20:58467333-58467355 CCCCAGGCAGCCAGGCCCGGGCC 0: 1
1: 1
2: 7
3: 73
4: 652
Right 1175367757 20:58467370-58467392 CGCGCAGTCCCGGCCGGCGCGGG 0: 1
1: 0
2: 1
3: 18
4: 178
1175367748_1175367757 4 Left 1175367748 20:58467343-58467365 CCAGGCCCGGGCCGGAGGCAGCC 0: 1
1: 0
2: 1
3: 52
4: 427
Right 1175367757 20:58467370-58467392 CGCGCAGTCCCGGCCGGCGCGGG 0: 1
1: 0
2: 1
3: 18
4: 178
1175367745_1175367757 12 Left 1175367745 20:58467335-58467357 CCAGGCAGCCAGGCCCGGGCCGG 0: 1
1: 0
2: 8
3: 46
4: 502
Right 1175367757 20:58467370-58467392 CGCGCAGTCCCGGCCGGCGCGGG 0: 1
1: 0
2: 1
3: 18
4: 178
1175367749_1175367757 -1 Left 1175367749 20:58467348-58467370 CCCGGGCCGGAGGCAGCCGCCGC 0: 1
1: 0
2: 3
3: 51
4: 366
Right 1175367757 20:58467370-58467392 CGCGCAGTCCCGGCCGGCGCGGG 0: 1
1: 0
2: 1
3: 18
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175367757 Original CRISPR CGCGCAGTCCCGGCCGGCGC GGG Exonic
900289704 1:1918767-1918789 CGCCCAGTCCCGGCCGCTGGCGG - Intronic
900342266 1:2194755-2194777 CGCTCACTTCCGCCCGGCGCGGG - Exonic
900671255 1:3856631-3856653 TGGGCCGTCCCGGCCGGGGCAGG + Intronic
903153225 1:21428051-21428073 AGCGCAGTGCTGGCCGGGGCCGG + Intergenic
903777143 1:25800358-25800380 GGCGCAGACCCGGACGGCGGCGG - Exonic
905553001 1:38859253-38859275 CGCACAGGCGCGGCCCGCGCGGG - Intronic
906117995 1:43368102-43368124 AGCGCAGGCTCGGCCGGGGCGGG + Intergenic
906140633 1:43531632-43531654 CGTGCGGTCCCGGGCTGCGCCGG + Intronic
906430301 1:45750639-45750661 CGCGCAGTCGCGACCAGCCCCGG + Exonic
908132084 1:61083464-61083486 GGCGCTGTCCGGGCCGGGGCCGG - Intronic
912069840 1:105795918-105795940 CGCGCAGCCCCGGCTCCCGCTGG - Intergenic
915325253 1:155078736-155078758 CGCGCGCTCCCGACCGGAGCGGG + Intergenic
915463498 1:156082773-156082795 CCCCCAGGACCGGCCGGCGCGGG - Intronic
918040791 1:180912865-180912887 CGCGCCTTCCCGGCCCGCGCTGG - Intergenic
918365653 1:183805139-183805161 CGCGCTGCCCCCGCCGCCGCCGG - Intronic
919451229 1:197775234-197775256 CGCGCCGTCCCCGCCCACGCCGG + Exonic
919926474 1:202194251-202194273 CGCCCAGTCCCGGCCTCAGCAGG + Intronic
919991284 1:202709926-202709948 GGCGCAGAGCCGGCCGGTGCAGG + Intronic
921692273 1:218164943-218164965 CCTCCAGTCCCGGGCGGCGCCGG + Intergenic
924763156 1:247007739-247007761 CCCTCAGTCCCGTCCCGCGCAGG - Intronic
924775256 1:247111634-247111656 CGCGCCCTCCCCGCCGGTGCCGG + Exonic
924801457 1:247331817-247331839 GGCGCAGGCCTGGCCGCCGCGGG + Intronic
1065099895 10:22321863-22321885 CGCGCGGGGCCGGCAGGCGCGGG - Intronic
1066235501 10:33480816-33480838 CGCGCAGCCCCGGTTGCCGCCGG + Intergenic
1067078775 10:43202581-43202603 CGCGGAGTCTTGGCTGGCGCAGG - Intronic
1069659097 10:70111791-70111813 CGGGCAGGTCCTGCCGGCGCAGG + Exonic
1070609936 10:77926395-77926417 CGCTCAGTCCCGGCGAGCGGCGG - Exonic
1071309371 10:84328540-84328562 CGCGCAGTCCCGCCCCGCCGCGG - Intergenic
1071309385 10:84328586-84328608 GGCGGAGTCCGGGCGGGCGCCGG + Exonic
1071997555 10:91162973-91162995 CGCCCCGCCCCCGCCGGCGCGGG + Intergenic
1074095043 10:110304567-110304589 CTCGGCGGCCCGGCCGGCGCTGG - Intronic
1074377420 10:112951367-112951389 CGCCCCGACCGGGCCGGCGCAGG - Intronic
1074722228 10:116272975-116272997 CCCGCAGTCCCGGCGTGCCCCGG + Intronic
1074772393 10:116742473-116742495 CGCGCAGCCCCGGACCGCGAGGG + Exonic
1075522998 10:123155084-123155106 GGCGCAGTCCAGGACGGCGCCGG - Exonic
1075645464 10:124093335-124093357 CGCCCAGCCCCGGCCGCCGCCGG + Intronic
1075753431 10:124792004-124792026 CGCACGGTCCCCGCCGGCGCAGG - Intergenic
1076156604 10:128210354-128210376 CGCGCCTTCCCGGGCGGGGCGGG + Intergenic
1076683197 10:132185858-132185880 CGCGCGGTCACGGCAGGAGCGGG - Intergenic
1076895368 10:133308846-133308868 CGCGCAGCCCCCGACGGCGGCGG + Exonic
1080889648 11:36398360-36398382 AGCGCTGGCCCGGCAGGCGCGGG - Intronic
1091866107 12:3838876-3838898 CGCGCACGCCGGGCCGGCTCAGG - Intronic
1092695887 12:11171180-11171202 CGCGTAGCCCCGGGCGCCGCTGG - Intronic
1096208193 12:49741250-49741272 CGGGCTGTCCCGGGCGGGGCCGG + Intronic
1101144814 12:101830921-101830943 CGGCCAGACCCGGGCGGCGCCGG - Exonic
1101772058 12:107760926-107760948 CGCGCGGGCCCGGCCGGAGCGGG - Intronic
1102339214 12:112108602-112108624 CGCGCGGGCCGGGCAGGCGCAGG - Intronic
1103595558 12:122022585-122022607 CGCGCTCTCCCCGCCGCCGCCGG - Intronic
1105745706 13:23375441-23375463 CCCGCCCTCCCGGCCCGCGCGGG - Intronic
1105890734 13:24680765-24680787 CTCGCATCCTCGGCCGGCGCGGG - Intronic
1106109012 13:26760690-26760712 CGCGCCCTCCCGGCCCGCTCCGG - Exonic
1106246585 13:27954699-27954721 CGTCCACTCCCGGCCGCCGCGGG - Intergenic
1106683453 13:32031643-32031665 TGAGCACTCCCGGCCGGAGCCGG + Exonic
1108340675 13:49496052-49496074 CCCGGAGGCCCGGCCCGCGCAGG + Exonic
1112565381 13:100547518-100547540 AGCGCAGACCAGGCCTGCGCGGG - Intronic
1113874249 13:113584773-113584795 CGGGCGGTCCCGGCCGTGGCGGG - Exonic
1115555089 14:34539373-34539395 CGCGCAGTCCCGGGGGGAGGCGG - Intronic
1115651169 14:35403984-35404006 CCCGCGGCCCCGGCGGGCGCCGG + Intronic
1120789083 14:88562977-88562999 CGCGCAGTGCCGGCCGGGGCGGG + Exonic
1121595282 14:95157438-95157460 TGCGCAGTCTCCGCAGGCGCCGG - Intronic
1122917458 14:104865594-104865616 CGCGGGGTCCCGGCCGAGGCCGG + Intronic
1122976946 14:105174629-105174651 GGCGCAGCCGCGGCCGCCGCCGG - Intronic
1123061858 14:105598098-105598120 CGCGCAGTCCCAGAGGGCCCCGG - Intergenic
1123086598 14:105719829-105719851 CGCGCAGTCCCAGAGGGCCCCGG - Intergenic
1124340311 15:28886015-28886037 GGCGCAGGCCCGGCAGCCGCAGG + Exonic
1124497661 15:30196236-30196258 CGCGCAGTCCCGGGGCGGGCCGG - Intergenic
1124745925 15:32342455-32342477 CGCGCAGTCCCGGGGCGGGCCGG + Intergenic
1126436764 15:48645323-48645345 CGCGCCGTCCCCGCCGACTCCGG + Intronic
1127343090 15:58066484-58066506 CGGGCGGTCCCGGCCGGCAGAGG - Intronic
1127391897 15:58512539-58512561 CTCGCAGACCCAGCCGGCCCAGG - Intronic
1127768083 15:62207546-62207568 CGCGCAGCCCCGGCTCCCGCTGG - Intergenic
1129379276 15:75155091-75155113 CTCGCAGTCCCAGCCGCCCCAGG - Intergenic
1129483271 15:75843994-75844016 CGCGCAGTCCCAGCCCGGCCTGG - Intronic
1129592754 15:76931887-76931909 TGCGCCGCCGCGGCCGGCGCCGG + Exonic
1129854041 15:78811545-78811567 CGCCCCGCCCCGGCCGGCCCCGG + Intronic
1131517403 15:93088579-93088601 CGCGGAGCCCCGGACGGAGCCGG - Intronic
1132727087 16:1343573-1343595 CGCTCAGTGCCGGTCGGCGAGGG + Intronic
1132742294 16:1420885-1420907 CGCGCACTCCGGGCCTGCGACGG - Intergenic
1132798891 16:1741790-1741812 AGCCCAGTCCCAGCCGGCCCTGG + Intronic
1132878026 16:2148865-2148887 AGCGCAGTCCCGGAGCGCGCCGG - Exonic
1132881622 16:2164085-2164107 AGCGCAGTCCCGTCCCGAGCTGG + Intronic
1132915226 16:2340441-2340463 CCCGCAGGCCAGGCCGGAGCTGG + Intronic
1133156715 16:3880927-3880949 CCCGCAGGCCTGGCCCGCGCCGG - Intergenic
1134482989 16:14634225-14634247 CGTGCAGTCCCTGCCGGCTCGGG - Intronic
1136141638 16:28292538-28292560 AGCGCAGCCCGGGCGGGCGCCGG + Exonic
1137280578 16:46973375-46973397 GGGCCAGTCACGGCCGGCGCCGG + Intronic
1137738498 16:50742349-50742371 CCCGCGGGCCCGGCCGGCTCGGG - Intronic
1141619267 16:85228159-85228181 CGCTGAGTCCCGGCCCCCGCCGG + Intergenic
1141983043 16:87561680-87561702 CACGCAGCCCCGGCTGGCTCAGG - Intergenic
1142397838 16:89842791-89842813 TGGGCAGTCCTGGCCCGCGCTGG - Intronic
1142699234 17:1649386-1649408 AGCGCAGCCCCGGCCAGGGCAGG - Intronic
1142860048 17:2755811-2755833 CCCCGAGGCCCGGCCGGCGCGGG + Intergenic
1143078853 17:4366641-4366663 CGCGCAGGGCCGCTCGGCGCAGG + Intergenic
1143183510 17:4997954-4997976 CGCGCTGCCCGGGCGGGCGCCGG + Exonic
1146581160 17:34040016-34040038 CGGGCAGCCACCGCCGGCGCCGG + Intronic
1147653025 17:42072718-42072740 CGCGCCGCCCCCGCCGGCCCAGG + Intergenic
1149994477 17:61399578-61399600 CGCGCTCTCCAGTCCGGCGCAGG + Intergenic
1150108605 17:62479130-62479152 CGGGCAGCCGCCGCCGGCGCCGG - Exonic
1150433470 17:65137247-65137269 CGCGGGGTCCCGGCGGGGGCCGG + Intergenic
1152231934 17:79118096-79118118 CCCCCAGTGCCGGCCGGCCCTGG + Intronic
1152831064 17:82497304-82497326 CGCGCAGCCCCGGCCCTCACGGG + Intergenic
1153265075 18:3262012-3262034 CACGCAGACCCCGCCGGCCCGGG + Intronic
1155872013 18:31041811-31041833 CGCGCAGTCCTCCCCGGAGCCGG + Intronic
1160024088 18:75204676-75204698 TGCGCGGTCCCGGCCCGCCCGGG - Intronic
1160242602 18:77133723-77133745 AGCGCTGTCCCGGCCCGCGCTGG + Intergenic
1160579348 18:79874845-79874867 CCTGAAGTCCCGGCCTGCGCTGG - Intronic
1160767040 19:813292-813314 CGTGCAGGCGCGGCCGGGGCTGG - Exonic
1161077142 19:2291302-2291324 CGCCCACTTCCAGCCGGCGCAGG + Exonic
1161266382 19:3366598-3366620 GGCGCAGGGCCGGCCGGAGCGGG - Exonic
1162158956 19:8697879-8697901 GGAGCAGGCCCGGCCGGAGCAGG - Exonic
1162412380 19:10514311-10514333 CCCGCAGTCCCGGGCCGTGCCGG + Exonic
1162975885 19:14206774-14206796 CGCGCGGACCGAGCCGGCGCCGG + Intergenic
1163631439 19:18419759-18419781 CGCGCGGTGCCCGCCCGCGCCGG - Intronic
1165157042 19:33795471-33795493 CGTCCAGGCCCGGCCGGAGCCGG + Intergenic
1166660467 19:44643869-44643891 CGGCCAGTCCCGCCAGGCGCGGG - Exonic
1168218614 19:54944524-54944546 CTCAGAGACCCGGCCGGCGCGGG + Intronic
926268028 2:11344216-11344238 GGTGGAGTCCCGGCCGGAGCTGG - Exonic
926301907 2:11610928-11610950 CGTGCGGGCCCGGCTGGCGCTGG + Exonic
927981139 2:27375868-27375890 CGAGCAGCCCAGGCCGGGGCCGG + Exonic
929460918 2:42101564-42101586 CGTGCAGTCCCGCCGGACGCCGG + Intergenic
932399019 2:71466793-71466815 CGCGCAGTCAGGGCGGGAGCGGG - Exonic
934539125 2:95159778-95159800 TGCGCAGACGCGGCCGCCGCCGG + Intronic
944675843 2:202033864-202033886 CGCTCACTCCCGGCGGGCGGCGG + Intergenic
947353647 2:229271352-229271374 CGCGCAGGTCCGGGCGGCGGCGG - Intergenic
947506659 2:230713051-230713073 CGCGCAGCCGCCGCCGCCGCGGG + Exonic
947523355 2:230864839-230864861 GGCGCAGGCGCGGCGGGCGCCGG + Intronic
1169073743 20:2749531-2749553 GGCCCAGCCCCGGCCGCCGCGGG + Intronic
1169164061 20:3407521-3407543 GGGGCAGCCCCTGCCGGCGCGGG + Exonic
1169164115 20:3407684-3407706 CGCGCGGGCCCGGCGGGGGCGGG + Intergenic
1172028946 20:31968246-31968268 GGGGCAGTGCCGGCGGGCGCGGG + Exonic
1172095426 20:32457823-32457845 CTCGGAGTCCCGGCCCGCGCTGG + Intronic
1174216750 20:48921795-48921817 CCCGGCGTCCCGGCCGGCACCGG - Intergenic
1174231234 20:49046862-49046884 CCCGCAGTCCCCGCCCGGGCAGG - Intronic
1175367757 20:58467370-58467392 CGCGCAGTCCCGGCCGGCGCGGG + Exonic
1175383619 20:58580337-58580359 CCTGCAGTCCCGGCCCCCGCTGG - Intergenic
1177580999 21:23021681-23021703 CGCGCGGACCCGGCCTCCGCTGG + Intergenic
1178708039 21:34890148-34890170 CGCGCAGTCCGGGCCCGCCCGGG - Intronic
1179133511 21:38660360-38660382 CGAGCCGTCCCTCCCGGCGCTGG + Intronic
1179545370 21:42109676-42109698 CTCACAGGCCCGGCCTGCGCGGG - Exonic
1181831716 22:25565157-25565179 CCAGCTGCCCCGGCCGGCGCCGG + Intronic
1182547553 22:31084875-31084897 CGCGCCGGCCCGGCCCCCGCTGG + Intronic
1184101504 22:42343736-42343758 CGCGGGCTCCCGGCGGGCGCGGG + Intergenic
1184766866 22:46576849-46576871 CGCGCACGCGCGGCCGCCGCCGG - Intronic
1185055125 22:48575437-48575459 GGCGCAGTCGCTGCCGGCCCAGG - Intronic
949559475 3:5188323-5188345 CGCGCGGCCCCGGGCGGCGGGGG - Intronic
949993769 3:9600800-9600822 CGCGCACTCTCGGGCGGCGAAGG - Intergenic
950534426 3:13571010-13571032 GGTGCAGTCCAGGCAGGCGCAGG + Exonic
954838803 3:53494211-53494233 CGCGGAGTCGGGGCCGGCGCGGG + Intergenic
954909026 3:54087774-54087796 CACGCAGTCCCCGCCGCCGCGGG + Intergenic
957792546 3:84959273-84959295 CGGGCAGCCCCGGCGGGCTCTGG + Intronic
966852739 3:184174824-184174846 CGCGCAGCCGGGGCCGGGGCGGG + Intronic
967055223 3:185824722-185824744 CGCTCAGGCCGGGACGGCGCCGG - Intronic
967055225 3:185824724-185824746 GGCGCCGTCCCGGCCTGAGCGGG + Intronic
968319264 3:197750580-197750602 CGGGCGTTCCAGGCCGGCGCCGG + Intronic
968831534 4:2934762-2934784 CGCGCAGCCGCGGCAGGTGCGGG - Intronic
969696949 4:8740316-8740338 CGCCCAGTCCCTGATGGCGCCGG + Intergenic
972437102 4:39044926-39044948 CGCTCCGGGCCGGCCGGCGCCGG + Intergenic
973110381 4:46390286-46390308 GGCGCAGACCCGGGCGGCGTCGG + Intronic
973246594 4:48016754-48016776 CCCGCAGCCCCGCCCGCCGCGGG + Exonic
976092425 4:81471975-81471997 CGCCCCGCCCCGGCAGGCGCGGG + Intronic
977607233 4:98995588-98995610 TGCGTGGTCCCGGCCGGCCCTGG + Intergenic
980930351 4:139177703-139177725 CGTGCGGTCCCGGCCGGCGGGGG - Intergenic
981474978 4:145179704-145179726 CGCGCAGCCCCGGCCGTGGGCGG + Intronic
987132470 5:14872028-14872050 CGCGGAGCCTCGGCCGGCCCGGG + Intergenic
990825423 5:59893348-59893370 CGGGCAGCCCCGGGCGGCGGCGG + Exonic
1004241365 6:13925100-13925122 CCCGCAGTCCTGGACGGCGCCGG + Intronic
1006472482 6:34236652-34236674 CTCGCAGTCCCGGACGGAGGAGG - Intergenic
1006759027 6:36443075-36443097 CGCGCTGTCCCGCTCGGGGCTGG - Exonic
1011633896 6:89352811-89352833 AGCGCCGCCCCGGCCGGCGCCGG - Exonic
1013330316 6:109094585-109094607 CGAGCCTTCCCTGCCGGCGCCGG - Exonic
1014931604 6:127343156-127343178 CGCGCAGGCCTGCCCCGCGCTGG - Intronic
1015994888 6:138987745-138987767 CGCGCAGCCCCTGCCGGCCCAGG - Exonic
1018400446 6:163415024-163415046 CGCGCGGTGCCGGCCGCCCCGGG + Exonic
1027361502 7:77415556-77415578 CGCGCAGCCCCAGCCTGCACAGG + Intronic
1028984114 7:96996692-96996714 CAGGCAGCCCCGGCCGGGGCAGG + Intergenic
1029640764 7:101817447-101817469 CGCGGAGTCCCCGGCGCCGCGGG + Intronic
1033406020 7:141072638-141072660 CGCGCTCTCTCGTCCGGCGCGGG - Intergenic
1034174568 7:149090645-149090667 CCCGCGGTCCCGCCCGGCCCTGG + Exonic
1034262560 7:149765920-149765942 GCCGCAGTCCGGGCAGGCGCAGG + Exonic
1034446157 7:151115262-151115284 CGCGCAGCACTGGCCAGCGCTGG - Intronic
1034994717 7:155570616-155570638 CGGGCACTCCGGGCCAGCGCAGG + Intergenic
1035153395 7:156893200-156893222 CGCGCAGTCGGGGGCGGGGCGGG + Exonic
1037928971 8:22865936-22865958 CGGGCAGCACCGCCCGGCGCCGG - Intronic
1044698900 8:94949159-94949181 CGCGCAGCCCCGCACGGCCCGGG - Exonic
1049721079 8:144115869-144115891 CACGCAGGCCCCGCCGGCGCAGG - Intronic
1049780951 8:144428645-144428667 CCCGAAGTCCGGGCGGGCGCGGG - Intergenic
1055757619 9:79572652-79572674 CGGGCGGTCCCGGCCCCCGCCGG - Exonic
1058885820 9:109320635-109320657 CGCGCCGGCCCGGCCAGCGCCGG + Exonic
1060087471 9:120714919-120714941 CGCGCGGTCCCCGCCCGAGCTGG - Intergenic
1060700732 9:125747318-125747340 CGCGCGCTCCCCGCCCGCGCGGG - Intergenic
1060929497 9:127479838-127479860 GGAGCAGTCCCGGCTGGAGCAGG + Exonic
1061541042 9:131277932-131277954 CGCGGGGGCCGGGCCGGCGCAGG - Intergenic
1061712748 9:132499040-132499062 CACACAGTCCCTGCCGGCGGCGG - Intronic
1061975790 9:134067583-134067605 CGCGGAGGCCGGGCTGGCGCGGG + Intronic
1189296642 X:39923178-39923200 CTCGCAGTCCCGTCCTGCACAGG + Intergenic
1190096233 X:47483051-47483073 CGCGGGGTCCCGGCCGCCGCGGG - Intergenic
1192580479 X:72277125-72277147 CGGGCAGCCCCGGCCGGGGGAGG + Intronic
1198807297 X:140504741-140504763 CCCGCAGCCCCGGGAGGCGCAGG - Exonic