ID: 1175368499

View in Genome Browser
Species Human (GRCh38)
Location 20:58471226-58471248
Sequence CCTCCACCAAGGAGCCCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 3, 3: 49, 4: 273}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175368488_1175368499 1 Left 1175368488 20:58471202-58471224 CCTATCCCTAGAGCAGACCACTC 0: 1
1: 0
2: 2
3: 11
4: 98
Right 1175368499 20:58471226-58471248 CCTCCACCAAGGAGCCCTGGGGG 0: 1
1: 0
2: 3
3: 49
4: 273
1175368490_1175368499 -5 Left 1175368490 20:58471208-58471230 CCTAGAGCAGACCACTCCCCTCC 0: 1
1: 0
2: 8
3: 572
4: 19140
Right 1175368499 20:58471226-58471248 CCTCCACCAAGGAGCCCTGGGGG 0: 1
1: 0
2: 3
3: 49
4: 273
1175368487_1175368499 6 Left 1175368487 20:58471197-58471219 CCTAGCCTATCCCTAGAGCAGAC 0: 1
1: 0
2: 0
3: 10
4: 96
Right 1175368499 20:58471226-58471248 CCTCCACCAAGGAGCCCTGGGGG 0: 1
1: 0
2: 3
3: 49
4: 273
1175368484_1175368499 30 Left 1175368484 20:58471173-58471195 CCAAGGTGCTGGGGACAGTGGGG 0: 2
1: 1
2: 5
3: 66
4: 673
Right 1175368499 20:58471226-58471248 CCTCCACCAAGGAGCCCTGGGGG 0: 1
1: 0
2: 3
3: 49
4: 273
1175368489_1175368499 -4 Left 1175368489 20:58471207-58471229 CCCTAGAGCAGACCACTCCCCTC 0: 1
1: 0
2: 1
3: 16
4: 170
Right 1175368499 20:58471226-58471248 CCTCCACCAAGGAGCCCTGGGGG 0: 1
1: 0
2: 3
3: 49
4: 273
1175368486_1175368499 7 Left 1175368486 20:58471196-58471218 CCCTAGCCTATCCCTAGAGCAGA 0: 1
1: 0
2: 0
3: 8
4: 97
Right 1175368499 20:58471226-58471248 CCTCCACCAAGGAGCCCTGGGGG 0: 1
1: 0
2: 3
3: 49
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175368499 Original CRISPR CCTCCACCAAGGAGCCCTGG GGG Intronic
900206791 1:1435060-1435082 CTTCCTCCAAGAAGCCCAGGTGG + Intronic
900618118 1:3574432-3574454 CCTCCTCCAGGAAGCCCTTGGGG + Intronic
901716090 1:11155719-11155741 CATCAACAAAGGAGCCCAGGGGG - Intronic
902110160 1:14071689-14071711 TCTCTCCCAAGGAGCTCTGGTGG + Intergenic
902242296 1:15096995-15097017 CCTCCTCCAGGAAGCCCTGGGGG - Intronic
902265485 1:15260500-15260522 CCTCCAGCCAAGAGCCCAGGCGG - Intronic
902509887 1:16960820-16960842 CCTCCTCCAGGGAGCCCAGCAGG - Exonic
903754407 1:25650992-25651014 ACTCCTCCAAGGAGACCTGGAGG + Intronic
905676180 1:39826848-39826870 CCTGGAACAAGGAGCCTTGGGGG + Intergenic
905698791 1:39996162-39996184 CTTGCACCAAGGGGCCCTGTGGG - Intergenic
906658208 1:47564060-47564082 CCTCCTCTAAGAAGCCCTTGGGG + Intergenic
906954243 1:50359136-50359158 CCTCCCCCAAGGAGCTCAGATGG - Intergenic
907280835 1:53346190-53346212 CCTCCTCCAGGAAGCCCTGCTGG - Intergenic
913198361 1:116476181-116476203 CCTCATCCAAGGAGCCCTGATGG + Intergenic
913335082 1:117702588-117702610 ACTCCGCCTAGGAGACCTGGAGG + Intergenic
914753364 1:150550068-150550090 TCTCCAGCAGGGAGACCTGGGGG + Intronic
915213188 1:154324967-154324989 CCTCCACCCAGGGGGCGTGGTGG + Exonic
915284909 1:154846391-154846413 CCTCCAGAAAGGAGCCTCGGGGG - Intronic
915562047 1:156693152-156693174 CCTCCCCCAATGATCTCTGGAGG - Intergenic
917307164 1:173638504-173638526 CCTCCAGCAAGGAGCAAGGGGGG + Intronic
917920365 1:179744730-179744752 CCTCCCCCAGGGCGCCCAGGGGG + Intronic
919859783 1:201731892-201731914 CCTCCACAGAGGGGCCCTGGGGG + Intronic
920179329 1:204122847-204122869 CCTTCACCAAGGAAGCCTGTGGG - Exonic
921840542 1:219823510-219823532 GCTCCACTATGGTGCCCTGGTGG + Intronic
922082969 1:222315785-222315807 CCTCAAGCAAAGAGCCCTTGAGG - Intergenic
922682948 1:227616113-227616135 CCTCCCCCAAGAGGCCGTGGTGG + Intronic
922693581 1:227713794-227713816 CCTCCACCAAGGATCTCAGATGG - Intergenic
1063653861 10:7967436-7967458 CTTCCACCAAGGTGGTCTGGGGG - Intronic
1064029435 10:11874605-11874627 CCTCCCCCCAGCAGCCCTGGCGG - Intergenic
1065785247 10:29206976-29206998 GCTTCACCAAGAATCCCTGGTGG - Intergenic
1067058243 10:43064688-43064710 CCTCCACCTGGAGGCCCTGGGGG - Intergenic
1067460567 10:46455197-46455219 GCATCCCCAAGGAGCCCTGGAGG - Intergenic
1067626625 10:47929406-47929428 GCATCCCCAAGGAGCCCTGGAGG + Intergenic
1067691664 10:48505753-48505775 CCTCCACCAGGCAGCCCTCCTGG - Intronic
1067755005 10:48998805-48998827 CCTCCCTCAAGGCTCCCTGGTGG + Intergenic
1067755006 10:48998808-48998830 GCTCCACCAGGGAGCCTTGAGGG - Intergenic
1068867689 10:61911963-61911985 CCTCCACCAAGGAGGGCAGCAGG + Intronic
1069920600 10:71813237-71813259 CCTTCAGCAGCGAGCCCTGGGGG - Exonic
1070707913 10:78655049-78655071 GCTCAGCCAAGGGGCCCTGGGGG - Intergenic
1071233110 10:83612023-83612045 CCACCAATAAGGAGCACTGGAGG - Intergenic
1074858745 10:117493094-117493116 TCTCTACCAGGGAGCCATGGAGG + Intergenic
1075258676 10:120944844-120944866 TGGCCAGCAAGGAGCCCTGGTGG - Intergenic
1075677856 10:124308667-124308689 CAGGCTCCAAGGAGCCCTGGAGG - Intergenic
1077008840 11:371137-371159 CCTCTTCCAAGGACCCCTTGAGG + Intronic
1077107703 11:849199-849221 CCTCCACCAGGCAGCCCCGCAGG - Intronic
1077227363 11:1444292-1444314 CCCACACCAGGCAGCCCTGGAGG - Intronic
1077664010 11:4092373-4092395 ACTCCCCCATGGATCCCTGGAGG - Exonic
1077875897 11:6305335-6305357 CCTCCACCACCGACCCCAGGGGG - Intergenic
1078577062 11:12511507-12511529 CCTCCCGGAAAGAGCCCTGGAGG - Exonic
1079124414 11:17708676-17708698 TCCCCACAAAGGAGCACTGGGGG - Intergenic
1079136171 11:17777049-17777071 CATCCATCAGGGATCCCTGGAGG - Intronic
1080261025 11:30349842-30349864 CCTCCACCACTGAGACCTGGTGG + Intergenic
1081340204 11:41918105-41918127 CCTCCACCCAGGAGCTCAGTAGG + Intergenic
1081682679 11:45019326-45019348 CCACCACCTAGGAGCTCTGGGGG - Intergenic
1081753368 11:45527844-45527866 CCTCATCCAAGGAGGTCTGGAGG - Intergenic
1083521832 11:63320898-63320920 CCTCCCCCAAGGAGCTCAGCTGG - Intronic
1083887415 11:65579589-65579611 CCTCCTCCAAGGAGACCTCCTGG - Intronic
1084190681 11:67497391-67497413 CCTCCTCCTGGGAGCCCCGGCGG - Exonic
1084223314 11:67698296-67698318 GCTCCACCATGGCACCCTGGTGG + Intergenic
1084969807 11:72764889-72764911 GCTCCACCAAGGAGCCATGCTGG + Intronic
1088849440 11:113693161-113693183 GCCCCACCAAGGGGCTCTGGTGG - Exonic
1089202791 11:116734637-116734659 CCTCCACGAATGAGCTGTGGTGG + Intergenic
1089268967 11:117288152-117288174 CCTTCATCAAGGAGCTCTTGTGG + Exonic
1089327764 11:117669101-117669123 CCTGCAGCAAGAGGCCCTGGGGG - Intronic
1089362161 11:117898127-117898149 CCTACATCAAGGAGACTTGGAGG + Intergenic
1089586424 11:119512566-119512588 CCATCCCCAGGGAGCCCTGGAGG - Intergenic
1089589548 11:119531692-119531714 CAACCACCCTGGAGCCCTGGGGG + Intergenic
1090128832 11:124118224-124118246 CCTCCAATAAGAAGGCCTGGTGG - Exonic
1091902592 12:4156541-4156563 CCTCAAGCAAGAAGTCCTGGTGG - Intergenic
1094441729 12:30485477-30485499 CCACCACCAAGGCACCCTGGGGG + Intergenic
1095742379 12:45621369-45621391 CCTCCAGCAAGCAGCCCTTGGGG - Intergenic
1096672878 12:53210773-53210795 CCCCCACCCAAGACCCCTGGAGG + Exonic
1096848629 12:54421273-54421295 GCTCCTCCCAGGAGCCTTGGTGG + Intergenic
1097161270 12:57048260-57048282 CCTCCACCAAGGGTTCCAGGAGG + Exonic
1098281417 12:68866396-68866418 CCTCCGCCAAGGAGCCAAGATGG - Intronic
1102157151 12:110739770-110739792 CCTCCTTCAAGGAGCCATGGTGG - Intronic
1102507816 12:113394874-113394896 CCTCCTCCAAGGAGTCCTCCTGG + Intronic
1103528229 12:121581361-121581383 CCTCCGCTAAGAAGCCCTGTAGG - Intergenic
1104140826 12:125984285-125984307 CCTCCACCAAGGGGCGTGGGGGG - Intergenic
1104765947 12:131330391-131330413 CTTCCACCAAGCAGCCCTCCAGG + Intergenic
1106890154 13:34236188-34236210 CCTCCCCCAAGGAGCCCAAAAGG + Intergenic
1107966150 13:45599985-45600007 CCTCCTCCAAAAAGCACTGGAGG - Intronic
1111598054 13:90435828-90435850 CCCCAACTAAGGATCCCTGGAGG + Intergenic
1112617917 13:101024411-101024433 TCACCAACCAGGAGCCCTGGGGG - Intergenic
1112836772 13:103524474-103524496 CTTCAAGCAAGGAGCTCTGGAGG - Intergenic
1114461174 14:22886986-22887008 CCTCCACCAAGGAAGCCGGACGG - Exonic
1115698211 14:35923430-35923452 CCTCCATCAAGGAGCACAGCTGG + Intronic
1116998589 14:51349598-51349620 CATCAACCAAGGATCCCTGAAGG + Intergenic
1119004209 14:70908570-70908592 CCACCACCCAGGACCCCTGGAGG - Intronic
1119525220 14:75317471-75317493 GCTCCACCTGGGAGCCCTAGGGG + Intergenic
1119628677 14:76206741-76206763 CATGCACCAAAGACCCCTGGAGG - Exonic
1120730803 14:87998999-87999021 CCTGCAGCAAGGAACCCTGATGG + Intergenic
1121850676 14:97218979-97219001 CCTGCGCCAAGGCGCCCTGCGGG + Intergenic
1122645061 14:103188943-103188965 CCTCCGCCCAGGAACCCTGGAGG + Intergenic
1122771733 14:104100736-104100758 CCTCCTCCAAGAAGCCTTGAGGG - Intronic
1122931023 14:104933157-104933179 CCTCCTCCAGGGAGCCCTCCAGG + Exonic
1122940933 14:104981070-104981092 CCCCCACCAAGATGGCCTGGAGG - Intergenic
1123113100 14:105882134-105882156 CCTCCCCAAAGCTGCCCTGGCGG + Intergenic
1123119700 14:105911002-105911024 CCTCCCCAAAGCTGCCCTGGCGG + Intergenic
1123494746 15:20814492-20814514 CCTGCACCGCGGAGCGCTGGAGG - Intergenic
1123551241 15:21383585-21383607 CCTGCACCGCGGAGCGCTGGAGG - Intergenic
1124013920 15:25860973-25860995 CCTCCACCACATAGCCCTGGTGG - Intronic
1125760639 15:42093619-42093641 CAGACACTAAGGAGCCCTGGGGG - Intronic
1129153213 15:73702244-73702266 CCTACCCCCAGGAGCCCTGGAGG + Exonic
1129743976 15:78005238-78005260 CCTCCTCCACTGAGCTCTGGAGG + Intronic
1129783159 15:78288097-78288119 CCTCCTCCAAGCAGCCCTTGAGG + Intronic
1130033829 15:80340570-80340592 CCTCCACCGAGTGGACCTGGGGG + Intergenic
1130928367 15:88401934-88401956 TCTCCAGCCAGGAGCCCTGGCGG - Intergenic
1131117981 15:89806067-89806089 CCTTCACCAGGGAGCCCTTGAGG + Exonic
1131500927 15:92965472-92965494 CGTCAACCCAGGAGCCCAGGAGG + Intronic
1132222407 15:100114770-100114792 CCTCCACCCAGGAAGCCTTGCGG - Intronic
1202959582 15_KI270727v1_random:110828-110850 CCTGCACCGCGGAGCGCTGGAGG - Intergenic
1132654647 16:1036720-1036742 CCTCCACCAAGGCCCCTCGGGGG - Intergenic
1136776345 16:32873815-32873837 CCTCTACCCAGAAGCCCTGCCGG - Intergenic
1136894269 16:33987697-33987719 CCTCTACCCAGAAGCCCTGCCGG + Intergenic
1138228729 16:55323181-55323203 ACTCCTCCAAGGAGCCATAGGGG - Intergenic
1138291829 16:55854489-55854511 CCTCCACCAAGGGGGCCTGAGGG + Intronic
1138505400 16:57475901-57475923 CCTCCAGCAAGGGGCCCCAGCGG - Exonic
1141058749 16:80843722-80843744 CCTCCACCAAACAGCCCAGCTGG - Intergenic
1141432482 16:83977581-83977603 CCTCCACAGAGGAGCTGTGGAGG + Intronic
1141435694 16:83998555-83998577 ACCCCAGCAAGGAGTCCTGGGGG - Intronic
1142122951 16:88396334-88396356 CCTCCTGCAGGGAGGCCTGGAGG + Intergenic
1203078760 16_KI270728v1_random:1135924-1135946 CCTCTACCCAGAAGCCCTGCCGG - Intergenic
1142809031 17:2386765-2386787 CCTTCCCCTAGGAGGCCTGGGGG + Exonic
1145811298 17:27765759-27765781 TGCCCATCAAGGAGCCCTGGAGG - Intronic
1145974697 17:28977405-28977427 CCTCCACCTCGGTGCCATGGGGG - Intronic
1147296858 17:39490639-39490661 TCTCCACCAGGGAGCTCTGGAGG - Exonic
1148580375 17:48739197-48739219 ACTGCCCCAAGGACCCCTGGAGG - Intergenic
1149650048 17:58271099-58271121 CCTCCAGCATGGTGCCCTGGAGG - Intronic
1150069094 17:62137455-62137477 ACTCCACCACGGAGCCCGTGTGG + Intergenic
1152314537 17:79572506-79572528 GATCCACCAGGGAGGCCTGGTGG - Intergenic
1152750525 17:82060506-82060528 CCTCCACCAAGGACACCGAGGGG + Intronic
1155056548 18:22188841-22188863 CCTGCCCCCAGGATCCCTGGAGG - Intronic
1155650041 18:28130655-28130677 CCTCTTCCAGGGAGCCCTGCGGG + Intronic
1155847765 18:30731108-30731130 CCTCCTCCAAGGAGCTCAAGTGG - Intergenic
1156298022 18:35810098-35810120 CCATCACCAAGGACCCCTGGGGG + Intergenic
1157185374 18:45536100-45536122 CCTCCTCCAAGAAGCCCTCCTGG - Intronic
1158319819 18:56250353-56250375 TCTCCACCAAGCAGCCACGGTGG + Intergenic
1158405612 18:57156802-57156824 CCTCCAGCAAGGAAGCCTGGAGG - Intergenic
1160128647 18:76204427-76204449 ACTCCACCCAGAAGCCCCGGGGG + Intergenic
1161084936 19:2330616-2330638 TCACCACCAAGGAGGCCCGGGGG + Intronic
1161298627 19:3532283-3532305 GCTCCCTCAAGGACCCCTGGGGG - Intronic
1161309672 19:3586670-3586692 CCTTCATCAAGGTGCCCGGGAGG + Exonic
1161352893 19:3803665-3803687 CCTCCTCCAGGAAGCCCTCGGGG + Intergenic
1161562067 19:4978947-4978969 CTTCCACCAAGAGGCCCTGCGGG - Intronic
1161947124 19:7444379-7444401 CCTCCTCCAGGGACTCCTGGCGG - Exonic
1163034644 19:14563729-14563751 CTGCCACCCAGGAGCCCAGGGGG - Intronic
1165722618 19:38090514-38090536 CCTCCTCCAGGGAGCTCTGGTGG - Intronic
1165889272 19:39100847-39100869 CCTCCACCCAGGTTACCTGGAGG - Exonic
1166044489 19:40222045-40222067 CCTCCACCAGGGGGCAATGGCGG - Intergenic
1166682978 19:44779268-44779290 CCTCCACCTAGGAGCCCATGGGG - Intronic
1167380411 19:49134939-49134961 CCCCCACCATGGAGCCCCGTTGG + Intronic
1167474083 19:49690205-49690227 TCTCCACCAAGGAGCCCTCGGGG + Exonic
1167527726 19:49995374-49995396 CCTCCAACAAGGAGACTTGGAGG - Intronic
1167605743 19:50480574-50480596 ACTCCACCAGGGAGCACTGTGGG - Exonic
1168233098 19:55045514-55045536 CCTCCCCCAAGGAGCCTTCCTGG + Intronic
1168433035 19:56296219-56296241 CCTCCTCCGAGAAGCCCTGCTGG - Intronic
926268518 2:11346408-11346430 CCTCCTCCATTGAGCCCAGGAGG + Intronic
927509205 2:23634043-23634065 CCTACACCAGGGAGCCGTGGGGG - Intronic
928254632 2:29711462-29711484 CTTCCCTCAAGGAGCTCTGGGGG - Intronic
929405533 2:41637283-41637305 CCTCCCCAAAGGAGCTCTGATGG - Intergenic
929728385 2:44457862-44457884 CCATCACCAAGCAGCCATGGAGG - Intronic
932076715 2:68671124-68671146 GTTCCACCCATGAGCCCTGGAGG - Intergenic
934559058 2:95302845-95302867 CCCACACCCAGGGGCCCTGGTGG + Intronic
934620426 2:95800057-95800079 CCACCAGCAAGTCGCCCTGGCGG - Intergenic
934682694 2:96296559-96296581 CCTGCACCAAGGAGCGCATGGGG + Exonic
937906759 2:127056263-127056285 CCAGCAGCAAGCAGCCCTGGAGG + Intronic
938552831 2:132396417-132396439 ACTCCACCATGGAGTCTTGGTGG - Intergenic
938561061 2:132472308-132472330 CCAGCAGCAAGGAGGCCTGGAGG - Intronic
941878517 2:170459546-170459568 CCCCCACCCAGGAGCCCAGTTGG + Intronic
942222447 2:173783871-173783893 CCTCCTCCAAGAAGCCCTCTTGG - Intergenic
942521555 2:176809414-176809436 CCTCCACCCTGGAGCTTTGGTGG + Intergenic
943216556 2:185044522-185044544 CCTCCTCCAAGGAGCTCAGATGG + Intergenic
944743860 2:202636014-202636036 CCACCACCAGGGAGCCGTGCGGG - Intronic
946400246 2:219464851-219464873 GCTCCATCACGGAGCCCTGGCGG + Intronic
946486157 2:220102842-220102864 CCTCCACCAGGAAGCCCTCCAGG + Intergenic
947274250 2:228372641-228372663 CCTCCATCAAGGAGCACAGCTGG - Intergenic
948095972 2:235334360-235334382 CCCCCACCACAGAGCCCTGCAGG + Intergenic
948900819 2:240956110-240956132 CCTCCCACCAGGAGCCCTGGAGG - Intronic
1169900515 20:10547884-10547906 CCTCCACAAAGGCCACCTGGTGG + Intronic
1171206595 20:23286538-23286560 CTGCCACCCAGGAGCCCTGCCGG - Intergenic
1171408918 20:24933303-24933325 CCTCCACCAAGGGCACCAGGGGG - Intergenic
1172205333 20:33159215-33159237 CCTCCGCCTGGGAGCCCTGCCGG - Intergenic
1174484943 20:50855181-50855203 TCTCCACCAAGCAGGGCTGGGGG - Intronic
1175368499 20:58471226-58471248 CCTCCACCAAGGAGCCCTGGGGG + Intronic
1175412098 20:58777174-58777196 TCTCCACCAAGTACACCTGGTGG - Intergenic
1175561570 20:59934186-59934208 CCCGCACCCAGGAGCCCAGGCGG - Intronic
1175833585 20:61979968-61979990 GCACCAACATGGAGCCCTGGGGG + Intronic
1176896246 21:14382732-14382754 CCTCCACAAAGGGGTCCTGGAGG + Intronic
1177788051 21:25693949-25693971 TCTCCACCACCCAGCCCTGGGGG + Intronic
1178366618 21:31993781-31993803 CTTCAACCAAGGTGACCTGGAGG + Intronic
1179878301 21:44282506-44282528 CCACCTCCAGGGAGCCGTGGCGG + Intergenic
1180042811 21:45288543-45288565 GGCCCTCCAAGGAGCCCTGGAGG + Intergenic
1181568282 22:23752556-23752578 CCCCCACCATGGCCCCCTGGGGG - Intergenic
1181890248 22:26056459-26056481 CTTCCACAAAGGAGACCTGTTGG + Intergenic
1182689820 22:32151597-32151619 AATCCCACAAGGAGCCCTGGGGG + Intronic
1182689946 22:32152672-32152694 AATCCCACAAGGAGCCCTGGGGG + Intronic
1183306642 22:37086382-37086404 CCTCCACCACGGGCTCCTGGCGG + Exonic
1183698450 22:39436582-39436604 CCTACACCAAGGGGCCCTCTGGG + Intronic
1184060006 22:42075631-42075653 CCTCCCCCAGTGAGCCCTGCTGG + Exonic
1184241389 22:43212832-43212854 CCACCAGCAAGAAGGCCTGGGGG + Intronic
1184286913 22:43477083-43477105 CCTCCAACAGGGAGCCCTCCTGG - Intronic
1184326871 22:43795010-43795032 CCTCCACCAAGGAGCTCCCCAGG + Intronic
1184371963 22:44088296-44088318 CCTCCTCCAAGAAGCCCTCCTGG - Intronic
1184450494 22:44579681-44579703 CCTCCTCCAGGAAGCCCTGGAGG + Intergenic
1184470029 22:44691097-44691119 CCTCCACCACACAGCCCTCGGGG - Intronic
1184517508 22:44971704-44971726 CCACCTCCAGGGAGCCCTCGTGG + Intronic
1184666678 22:45992924-45992946 CCTCCTCCAGGGAGCCCTCCTGG + Intergenic
1185023579 22:48394919-48394941 ACTCCACCAAGGCAGCCTGGAGG - Intergenic
1185041659 22:48507410-48507432 CCCCCAACCCGGAGCCCTGGGGG + Intronic
1185176192 22:49328335-49328357 CCTCCACCATCAACCCCTGGTGG - Intergenic
1185410499 22:50679075-50679097 CCTCTACCACAGCGCCCTGGGGG + Intergenic
950166417 3:10803808-10803830 GCTCTCCCAAGGAGTCCTGGTGG - Intergenic
950429323 3:12941783-12941805 CGGGCACCAAGGGGCCCTGGGGG + Exonic
953027794 3:39154613-39154635 CCTCCTCCAGGGAGCCTTCGTGG + Intergenic
954224448 3:49173105-49173127 CCTCCCTCAAGCAGCCATGGGGG + Exonic
954295368 3:49671720-49671742 CCTCCACAAAGGTGCCCAAGGGG + Intergenic
954375682 3:50193065-50193087 CCTCCAGCAAGGAGGCCAGGAGG - Intronic
954707418 3:52488558-52488580 CATCCGCAAAGGAGCCCTGGGGG - Exonic
956212658 3:66817651-66817673 TCTCCACCAAGGAGACTTGGAGG + Intergenic
958943009 3:100335168-100335190 CCTGCACAAAGGTGCCCAGGCGG + Intronic
961012977 3:123448369-123448391 GCTCCACCAAGAAACCCGGGGGG - Exonic
961467344 3:127089885-127089907 CCTCCTCCAGGGAGCCCTCTTGG - Intergenic
961468795 3:127098331-127098353 CCTGCCCCCAGGAGCCCTGAGGG - Intergenic
962317660 3:134368836-134368858 CCCTCAACATGGAGCCCTGGGGG - Intronic
962358214 3:134713242-134713264 CCTCCACTATGGAACCCAGGGGG + Intronic
962811117 3:138960411-138960433 CCTCCACCCAGGAACCCGGCCGG - Intergenic
964720502 3:159764304-159764326 CGTCCCCCAAGGAGGCCTGGGGG - Intronic
966734614 3:183179220-183179242 CCTCCTCCGAGGAGCCCGAGGGG - Exonic
966817943 3:183904591-183904613 CCTCCTCCAGGGGGCACTGGAGG + Intergenic
968505276 4:968447-968469 CCGGCCCCAGGGAGCCCTGGGGG - Intronic
969470345 4:7384121-7384143 CCTCCACCAAGGGCCTCTGCAGG - Intronic
969627100 4:8311204-8311226 TCTCCTCTAAGGAGCCATGGAGG - Intergenic
969921427 4:10544048-10544070 GGTCCACCAGGGAGCTCTGGAGG - Intronic
972768602 4:42174510-42174532 GCTCCGCAAAGGAGTCCTGGTGG - Intergenic
973880911 4:55270167-55270189 GCTCCACCCAGGACCCTTGGTGG - Intergenic
976602063 4:86946837-86946859 TCTCCACCAAAGAGCCCTAGGGG + Intronic
979826462 4:125240169-125240191 TCTCCACTAAGGACCCTTGGTGG + Intergenic
983077546 4:163344048-163344070 CCTGCACCGAGGGGCCGTGGCGG + Intronic
983351545 4:166596898-166596920 CTTGCACCAATGTGCCCTGGAGG + Intergenic
985489736 5:172236-172258 CCTCAGCCAAGGAGCCCTAGGGG + Intronic
985541696 5:490384-490406 CCTGCACCATGAAGCCCTGGAGG - Intronic
986690609 5:10310613-10310635 GCTCCACCAAGGAGTGCTGGAGG - Intergenic
987372657 5:17207512-17207534 CATCCAAGAAGGAGCTCTGGAGG + Intronic
987391036 5:17375634-17375656 CGTCCATCTAGGAGCCCTGCGGG - Intergenic
989213066 5:38876845-38876867 CATCCAACAAGGAGCCATGTTGG + Intronic
989368275 5:40679880-40679902 CCTCCTCCAAGTTTCCCTGGCGG - Exonic
994124035 5:96150309-96150331 CCTCAACCCTGGAGCCCTGGAGG - Intergenic
997439435 5:133898898-133898920 CCTCCTCCAAGCATGCCTGGGGG + Intergenic
998134422 5:139667261-139667283 CCTCCTCCAAGAAGCCCTCTGGG + Intronic
1002428111 5:179187597-179187619 CCTCCCCCCAGCAGCCCTGGGGG + Intronic
1002535889 5:179875176-179875198 CCTGCCCGCAGGAGCCCTGGTGG - Exonic
1002591525 5:180293896-180293918 GTTCCACCAAGGAGCACTGATGG + Intergenic
1004306795 6:14508556-14508578 CCTCCACCCAGTAGCCCTCAGGG + Intergenic
1006920921 6:37626491-37626513 CCTCCTTCAAGGAGCCTTTGGGG + Intergenic
1007498856 6:42280348-42280370 CCTCCTTCTAGAAGCCCTGGGGG + Intronic
1008433342 6:51446112-51446134 CATCCACCAAGCGGCCCAGGAGG - Intergenic
1008699459 6:54081234-54081256 CCGCCACCATGGAGACCTGCGGG - Intronic
1010282974 6:74041580-74041602 CCTCCCCCAAGGAGCCCTGATGG + Intergenic
1011766847 6:90629544-90629566 CATCCCCCAAGAGGCCCTGGTGG - Intergenic
1011875881 6:91960968-91960990 TCTCCACCACGGAGCCCTGGAGG + Intergenic
1014064677 6:117110939-117110961 CCTCCCCCAAGGAGCTCAGATGG - Intergenic
1017052091 6:150402747-150402769 CTTCCATCAAGGAGTACTGGAGG + Exonic
1017751605 6:157494039-157494061 CCTCCCCGCAGGAGCCCTGCAGG + Intronic
1019155845 6:170038387-170038409 CCTCCCCCCAGCAGCCCTGAGGG - Intergenic
1022527418 7:31047365-31047387 CCTTCAACCAGGGGCCCTGGAGG + Intergenic
1022712231 7:32862738-32862760 CCTGTACCAAGGAGTCCTGCAGG + Intergenic
1022911646 7:34904627-34904649 CCTGTACCAAGGAGTCCTGCAGG - Intergenic
1023207145 7:37763444-37763466 CCTCCTCCAAGGAGCCCAGAAGG - Intronic
1023819087 7:43970452-43970474 CCTCCTCCCAGCAGCCCTAGGGG - Intergenic
1023819136 7:43970716-43970738 CCTCCTCCCAGCAGCCCTAGGGG - Intergenic
1023984108 7:45085396-45085418 CATCCACCATGGACCCCTGCGGG + Exonic
1024215609 7:47245875-47245897 GCTCCAACAAGAAGTCCTGGAGG - Intergenic
1025756906 7:64352593-64352615 CATCAACCAAAGAGCGCTGGTGG + Exonic
1027229148 7:76262060-76262082 CCTCCACCCAGGAGGGCTGGGGG + Intronic
1028517949 7:91698753-91698775 CTTCCCCCAAGGAGCTCAGGTGG - Intronic
1029744140 7:102507411-102507433 CCTCCTCCCAGCAGCCCTAGGGG - Intronic
1029744187 7:102507679-102507701 CCTCCTCCCAGCAGCCCTAGGGG - Intronic
1029762131 7:102606574-102606596 CCTCCTCCCAGCAGCCCTAGGGG - Intronic
1029762178 7:102606841-102606863 CCTCCTCCCAGCAGCCCTAGGGG - Intronic
1032001387 7:128267672-128267694 CATCCACCAAGCAGCCCTCCTGG - Intergenic
1032077353 7:128842404-128842426 CCTCCCTCAGGGACCCCTGGTGG - Intronic
1032215264 7:129952632-129952654 CCTCCACCGAGGAGCCGGCGCGG - Exonic
1032503151 7:132415008-132415030 CCTCTACCAGGCAGCCCTGCTGG + Intronic
1033491398 7:141846948-141846970 CCTCCATCAAGGAGCACAGCTGG - Intergenic
1034252665 7:149704887-149704909 TGTGCACCAAGGAACCCTGGGGG - Intergenic
1037878904 8:22563328-22563350 CAGCCAGCAAGGGGCCCTGGAGG + Intronic
1038424249 8:27454264-27454286 CCACCACCACGTAGCCCTCGGGG - Exonic
1039658205 8:39433413-39433435 CCTCCCCCAAGGAGCTCAGATGG - Intergenic
1044038638 8:87337452-87337474 CCTCCCCCAAGGAGCTCAGATGG + Intronic
1044967431 8:97586683-97586705 CCTCCACCAACGGTCCTTGGTGG + Intergenic
1048458743 8:134602179-134602201 CATCCAGCAAGAAGCTCTGGGGG - Exonic
1048514240 8:135091363-135091385 CCTCCAGCAAGGAGGCTGGGAGG - Intergenic
1049381738 8:142319649-142319671 CCTGCACCAAGCAGGCCTTGGGG + Intronic
1049780504 8:144426535-144426557 GCTCCACCATGGCTCCCTGGCGG + Intronic
1049780505 8:144426538-144426560 ACTCCGCCAGGGAGCCATGGTGG - Intronic
1050177561 9:2884093-2884115 CCCCAACCAATGAGACCTGGTGG - Intergenic
1050992412 9:12170852-12170874 CCCCCACCAGGGAGTCCTAGAGG - Intergenic
1052199749 9:25763950-25763972 CCTCCCCCAAGGAGCTCAGAAGG - Intergenic
1056456133 9:86762772-86762794 CCTCCTCCAACGAGCTCTGGGGG - Intergenic
1057666411 9:97048880-97048902 CCTACCCCAGAGAGCCCTGGAGG + Intergenic
1059329498 9:113525904-113525926 CTACCACCCAGGAGCCCTGGGGG - Intronic
1059407792 9:114112683-114112705 CCTCTTCCAAGAAGCCCTGCTGG + Intergenic
1060666190 9:125433494-125433516 CCACCACCCAGGAGGTCTGGGGG - Intergenic
1061009376 9:127946130-127946152 CCTCCAGCAATGTGTCCTGGAGG - Intronic
1061301865 9:129710090-129710112 CCTCCTCCAAGAAGCCCTCCTGG - Intronic
1061324900 9:129857776-129857798 TCTCCAGCAAGAAGCCCAGGCGG - Intronic
1061367756 9:130181487-130181509 ATTCCACCCAGGAGCCCTGTGGG + Intronic
1061894001 9:133637475-133637497 CATCCACAAAGAAGCCCTGGTGG - Intronic
1062302792 9:135884899-135884921 CCTCCACCCATGGGCCGTGGAGG + Intronic
1062375509 9:136260140-136260162 TCTCCACCAGCGGGCCCTGGGGG + Intergenic
1062500801 9:136851218-136851240 CCTCCTCCAAGATGCCCTGGAGG - Intronic
1062624645 9:137437238-137437260 CCTCCTCCAAGCAGCCCTGCAGG + Exonic
1185642673 X:1597280-1597302 CCTCACCTAAGGAGCCCTCGGGG - Intronic
1189494881 X:41499866-41499888 TGCCAACCAAGGAGCCCTGGGGG + Intergenic
1189847750 X:45152026-45152048 CCTCCCTCAAGGAGCACTGGTGG - Intronic
1193227231 X:78998387-78998409 CCTCCCCCAAGGAGCTCAGATGG - Intergenic
1193719551 X:84971626-84971648 CCTCCCCCAAGGAGCTCAAGTGG + Intergenic
1195924811 X:110014863-110014885 CTTTCACCCAGGAGCTCTGGGGG - Intronic
1195979394 X:110561382-110561404 CCTCCCCCAAGGAGCTCAGATGG + Intergenic
1197049601 X:122042645-122042667 CCTCTCCCAAGGAGCTCAGGTGG + Intergenic
1197403959 X:126027690-126027712 CCTCCACCAAGGAGCTCAAATGG + Intergenic
1197807960 X:130415596-130415618 AATAGACCAAGGAGCCCTGGGGG + Intergenic
1200146014 X:153926837-153926859 CCCCTACCAAGGGGGCCTGGAGG - Intronic
1202182384 Y:22150660-22150682 CCTCCACGGAGGAGCATTGGGGG - Intergenic
1202208976 Y:22435742-22435764 CCTCCACGGAGGAGCATTGGGGG + Intergenic