ID: 1175370143

View in Genome Browser
Species Human (GRCh38)
Location 20:58482861-58482883
Sequence CTGTAAGTGCAGATGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 1, 2: 1, 3: 22, 4: 276}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175370143_1175370151 30 Left 1175370143 20:58482861-58482883 CCTCCTTCCATCTGCACTTACAG 0: 1
1: 1
2: 1
3: 22
4: 276
Right 1175370151 20:58482914-58482936 ACCTACTGTGTGCTTGGCCATGG 0: 1
1: 1
2: 5
3: 74
4: 388
1175370143_1175370150 24 Left 1175370143 20:58482861-58482883 CCTCCTTCCATCTGCACTTACAG 0: 1
1: 1
2: 1
3: 22
4: 276
Right 1175370150 20:58482908-58482930 TTGAGCACCTACTGTGTGCTTGG 0: 26
1: 216
2: 1033
3: 3117
4: 6848
1175370143_1175370146 -10 Left 1175370143 20:58482861-58482883 CCTCCTTCCATCTGCACTTACAG 0: 1
1: 1
2: 1
3: 22
4: 276
Right 1175370146 20:58482874-58482896 GCACTTACAGCCCCTGATCTTGG 0: 1
1: 0
2: 0
3: 9
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175370143 Original CRISPR CTGTAAGTGCAGATGGAAGG AGG (reversed) Intronic
900714911 1:4138053-4138075 CAGAAAGTGCTGGTGGAAGGGGG - Intergenic
902669145 1:17960519-17960541 CTGTGTGTGCAGAAGGAATGTGG - Intergenic
903282506 1:22257914-22257936 CTTTAAGTGGGGATGGCAGGAGG - Intergenic
904353625 1:29924606-29924628 CAGTAAATGCTGAGGGAAGGAGG - Intergenic
905118200 1:35660588-35660610 CTGTAAGTCCAGATGGACCTTGG - Intergenic
906124750 1:43420862-43420884 GTGGAAGTGACGATGGAAGGCGG + Exonic
906257999 1:44365383-44365405 CTCTCACTGCAGCTGGAAGGAGG - Intergenic
906977550 1:50591783-50591805 CTGTTAGTGCAGAAGAAAGTCGG - Intronic
907743073 1:57185657-57185679 GTATTAGCGCAGATGGAAGGTGG + Intronic
909559732 1:76996697-76996719 CAGTATGTACAGTTGGAAGGAGG + Intronic
909833845 1:80229109-80229131 GTATAAGTGCAGATTCAAGGTGG + Intergenic
910674082 1:89799918-89799940 CTGTAAGTGCATATGACAGAGGG + Intronic
911649057 1:100366684-100366706 CTGCAAGTGGAGGAGGAAGGAGG - Intronic
912527724 1:110297122-110297144 CTGTAATTCCAGATGGACGGAGG + Intergenic
916071974 1:161175787-161175809 AGGTAAGTGCAGGAGGAAGGAGG - Exonic
916306767 1:163344403-163344425 CTGGAAGTACAGGTGGAAGAGGG + Intronic
919866745 1:201788445-201788467 CTGGAAGGACAGAGGGAAGGGGG - Intronic
920069535 1:203292287-203292309 CTGGAAGTGGGGATGGAGGGTGG + Intergenic
920341273 1:205276526-205276548 CTCCAGATGCAGATGGAAGGAGG + Intergenic
920374734 1:205501856-205501878 GGGCAAGTGCAGATGGGAGGTGG - Intergenic
921286957 1:213617395-213617417 CTGGTTGTGGAGATGGAAGGAGG + Intergenic
921936078 1:220798494-220798516 ATCTGAGGGCAGATGGAAGGTGG - Intronic
922203337 1:223425637-223425659 CTCTAAGTGGAGATGTGAGGAGG - Intergenic
1063132507 10:3190328-3190350 CTGTATCAGCAGATGGAACGTGG + Intergenic
1063639117 10:7813558-7813580 CTGAAAGAGCAGATGCAAGATGG + Intergenic
1071801651 10:89069905-89069927 CTGAAGTTGCACATGGAAGGAGG + Intergenic
1075806306 10:125191332-125191354 CTTGCTGTGCAGATGGAAGGAGG + Intergenic
1076815621 10:132913388-132913410 CTGTAAATGCAGATGGAGTTTGG - Intronic
1078060042 11:8037421-8037443 CTGTAAGTGGTCATGGAAGAAGG - Intronic
1078153705 11:8780112-8780134 CTGTAAGTATGAATGGAAGGAGG - Intronic
1079102799 11:17552134-17552156 CTGAAAGGGCAGAGGGCAGGTGG + Intronic
1081378766 11:42389502-42389524 CTGTAGGTGCAAATGGAAGAAGG + Intergenic
1082866050 11:57901233-57901255 CTGAAAGTCCAGATGGACTGAGG - Intergenic
1083733578 11:64667189-64667211 ATGTCAGGGCAGATGGAAAGGGG + Intronic
1084116323 11:67044937-67044959 CTGTGAGGGCAGAGTGAAGGGGG + Intronic
1084460082 11:69292326-69292348 GTCTGAGAGCAGATGGAAGGAGG - Intergenic
1086498201 11:87425495-87425517 CTGTCAGGGCAGAGGGAATGAGG + Intergenic
1086938457 11:92769566-92769588 CTTTACCTGCAGATGGATGGGGG + Intronic
1086949531 11:92877353-92877375 CTGGTTGTGCAGAGGGAAGGTGG - Intronic
1088743376 11:112784956-112784978 CTGGAAGCCCAGATGGAGGGTGG + Intergenic
1089186034 11:116615289-116615311 CTGCAAGTGGAGCAGGAAGGGGG - Intergenic
1089560581 11:119341257-119341279 CTGAAAAAGCAGATGGAAAGGGG + Exonic
1089935870 11:122363460-122363482 CTGTAAGACCAAATGGAAGGAGG - Intergenic
1090141647 11:124271090-124271112 TTCTTAGGGCAGATGGAAGGGGG - Intergenic
1090948384 11:131451487-131451509 CTGGGGGTGCAGCTGGAAGGGGG + Intronic
1092043042 12:5402518-5402540 ATGTATGTGCACAGGGAAGGAGG + Intergenic
1093480271 12:19597399-19597421 CCGTAACTGCAGATGGGTGGGGG + Intronic
1095362932 12:41365997-41366019 GTGGCAGTGGAGATGGAAGGAGG + Intronic
1096054109 12:48636646-48636668 GAGCAAGTGCAGAGGGAAGGGGG + Intergenic
1100490391 12:95073079-95073101 CGGTAAGCGCAGCTGGAAAGGGG + Intronic
1101147658 12:101856223-101856245 CAGGAAGTGCAGAGTGAAGGTGG - Intergenic
1101565622 12:105902213-105902235 ATGTAAGTGCTGATGGAGAGTGG - Intergenic
1101649111 12:106658803-106658825 CTGTGAGTGGAGGTGGTAGGAGG - Intronic
1102075898 12:110060029-110060051 TGTTAAGTGCAGATGGAAAGGGG - Intronic
1104675935 12:130712488-130712510 CAGGACGTGCAGGTGGAAGGCGG - Intronic
1106430175 13:29673448-29673470 ATGTAAATGCGAATGGAAGGTGG + Intergenic
1106679601 13:31996654-31996676 CTGGAAGAGCAGATGGAAAGTGG + Intergenic
1106829611 13:33565218-33565240 CAGGAAGTGTAGAGGGAAGGGGG + Intergenic
1106901364 13:34357706-34357728 CTCTGAGAGCAGATGGCAGGTGG - Intergenic
1107918427 13:45177333-45177355 CTGAAACTGCAGATGGGAGGTGG - Intronic
1108708941 13:53014881-53014903 TTGCAAGGACAGATGGAAGGAGG - Intergenic
1109173967 13:59132432-59132454 CTGTAAGTGTACAGGGAAAGAGG - Intergenic
1113671652 13:112179617-112179639 CTGATACTGCAGAAGGAAGGGGG + Intergenic
1115141163 14:30172893-30172915 CTGGAAGTGAAGACAGAAGGGGG + Intronic
1115415819 14:33132188-33132210 ATGGAAGTGGAGATGAAAGGAGG + Intronic
1115740070 14:36378366-36378388 CTGAAAGTGCAGAGGCTAGGTGG - Intergenic
1116014105 14:39385992-39386014 CTGTAGGTGCTGCTGGATGGAGG - Intronic
1116707737 14:48324543-48324565 CTATCAGTGCAGGTAGAAGGAGG + Intergenic
1117902662 14:60551173-60551195 CTGGAAGTGAAGGTGGCAGGAGG + Intergenic
1119165314 14:72487614-72487636 CTGGCTTTGCAGATGGAAGGGGG + Intronic
1120401914 14:84043042-84043064 CTGAAAATGCAGATGGCAAGTGG - Intergenic
1121057382 14:90869520-90869542 CAGTAAGTGAAGAAGGGAGGGGG + Exonic
1121579820 14:95021124-95021146 CTCTGTGTGCACATGGAAGGAGG + Intergenic
1123823739 15:24059952-24059974 ATGTAATTGAAGAGGGAAGGAGG + Intergenic
1127005911 15:54570007-54570029 CTGTAAGTGGATGGGGAAGGAGG - Intronic
1127008313 15:54594975-54594997 TTCTTAGGGCAGATGGAAGGAGG + Intronic
1127148450 15:56049697-56049719 CTGTGAGTGCAGGTGGCAGGTGG + Intergenic
1127631997 15:60836271-60836293 CTTTATGTGCAGATGGAGAGAGG + Intronic
1127714373 15:61634560-61634582 CTCTAAGAGCTGATGGGAGGAGG - Intergenic
1129295808 15:74599457-74599479 CTGAAGGCGCAGATGGAGGGAGG + Intronic
1131310336 15:91284858-91284880 CTGCAAGTCCCGATGGAATGAGG - Intronic
1131340848 15:91599241-91599263 CTGCAAGTGCAGGTGGGAGATGG + Intergenic
1133876943 16:9743902-9743924 CAATAAGTGCGGGTGGAAGGGGG + Intergenic
1133929698 16:10222304-10222326 CTAGAATTGCAGATGGAAGAAGG + Intergenic
1134062671 16:11208451-11208473 CTGTAAGTGGAGGTGGGACGTGG + Intergenic
1134685763 16:16157043-16157065 CTGTAGGTTCAGAGGGAGGGAGG + Intronic
1135146724 16:19969128-19969150 CAGTCAGTGGAGATGGGAGGGGG + Intergenic
1135949997 16:26905305-26905327 CTGTAACTGGAGAGGGAAAGTGG - Intergenic
1137700692 16:50495754-50495776 CTGGAAGTGCAGCTGGCAGACGG - Intergenic
1137882263 16:52062381-52062403 CTGGCAATGCAGATGGAAGAAGG - Intronic
1139197270 16:64934069-64934091 CTGTCAGAGGAGATGGAATGAGG + Intergenic
1139923065 16:70471562-70471584 CTGGCAGAGCAGATGCAAGGAGG - Intronic
1140059150 16:71552916-71552938 CTCTAAGTGCAGATGGGAGAAGG + Intronic
1140236134 16:73160585-73160607 AGGGAAATGCAGATGGAAGGAGG - Intergenic
1141910404 16:87054658-87054680 CTGGAGTTGCAGATGGAAGTAGG + Intergenic
1143544327 17:7587643-7587665 CTGCAAGTGCAGAGGAATGGAGG - Exonic
1143916196 17:10295180-10295202 CTAGAAGAGCAGAGGGAAGGAGG - Intergenic
1144256619 17:13474723-13474745 CGGTAAATGCAGAGGGAAGCAGG + Intergenic
1145262463 17:21362792-21362814 ATGGATGTGCAGATGGATGGAGG + Intergenic
1145819119 17:27817783-27817805 CAATATGTGCAGAAGGAAGGAGG + Intronic
1146594620 17:34157618-34157640 CTAAAAATGCAGAAGGAAGGGGG + Intronic
1147424596 17:40340169-40340191 CTGGAAGTGCTGATGGACAGAGG - Intronic
1151287622 17:73124423-73124445 CTGTTGGTGAAGATAGAAGGAGG - Intergenic
1152311292 17:79551547-79551569 ATGGATGGGCAGATGGAAGGTGG + Intergenic
1153388500 18:4527799-4527821 TTCTTAGGGCAGATGGAAGGGGG + Intergenic
1156053598 18:32970485-32970507 CTTTAAGTGCCGATGTCAGGGGG - Intronic
1156183264 18:34630745-34630767 CTGTTCATGCAGCTGGAAGGTGG + Intronic
1157729870 18:49994158-49994180 CTGGAAGAGCATATGGCAGGAGG - Intronic
1158124963 18:54091009-54091031 CTGAAATTGAAGATGGAATGTGG - Intergenic
1158274311 18:55749870-55749892 CTGTAAGTGCATATGAAGGAGGG - Intergenic
1160899055 19:1417808-1417830 CTGGAAGTGCAGAGGGCTGGGGG + Intronic
1161881549 19:6957924-6957946 CTGTAAGTGCAAATGGAAGGAGG - Intergenic
1162333055 19:10042224-10042246 CTGAGAGTGGAGAGGGAAGGAGG - Intergenic
1163236065 19:16031403-16031425 CTGTGAGTGCAGATGTGGGGAGG + Intergenic
1163493350 19:17630283-17630305 CTGGAACTGCAGGGGGAAGGAGG + Exonic
1164730715 19:30502189-30502211 CTGTAAGTGCCCATGTAAAGAGG - Intronic
1166540168 19:43599803-43599825 CTCTAAGTGAGGATGGCAGGGGG - Exonic
1167037121 19:47001133-47001155 GGGTGTGTGCAGATGGAAGGTGG - Exonic
1167517407 19:49931027-49931049 AGGTAAGGGCAGGTGGAAGGTGG + Exonic
1167702727 19:51060094-51060116 CTGTGGGTGCAGAAAGAAGGTGG + Intronic
1168349112 19:55665954-55665976 TTGTAAGTAAAGATGGATGGCGG + Intronic
928321616 2:30287915-30287937 CTGAAAATGGAGATGGAAGATGG - Intronic
928447103 2:31342345-31342367 CTGTACGTGCATAGGGAAGGGGG - Intronic
928630154 2:33183204-33183226 CTGGAAGTGAAATTGGAAGGTGG - Intronic
930243450 2:48959426-48959448 CTGCAAGAGCAAATGGAGGGAGG - Intergenic
930936633 2:56960612-56960634 CTGTGAGTGCATGAGGAAGGAGG + Intergenic
931126769 2:59286703-59286725 CTGCCAGTGGAGCTGGAAGGGGG - Intergenic
932322963 2:70835340-70835362 CTGTTACTGCACATGGAAAGAGG + Intronic
932705538 2:74021477-74021499 CTGCATGTGCATATGGGAGGTGG + Intronic
933429454 2:82156989-82157011 TTGTAATTGCAGATGGATGATGG - Intergenic
933638639 2:84735045-84735067 CTGAAAGAGCAGATGGAGGGAGG - Intronic
935673562 2:105575667-105575689 CTGCAAGTTCAGAGGGAGGGTGG + Intergenic
937985715 2:127637266-127637288 CTGTGGGTGCAGAGGGCAGGTGG - Intronic
938115449 2:128600157-128600179 TTTTAAGGGCAGAAGGAAGGAGG + Intergenic
940012825 2:149072880-149072902 ATTTGAGTGAAGATGGAAGGAGG + Intronic
941963649 2:171278398-171278420 CTTCAAATGCAGATTGAAGGGGG + Intergenic
942413411 2:175734510-175734532 CTGCAAGTGCATGGGGAAGGGGG - Intergenic
943319729 2:186432513-186432535 CTGTAATTGCTGATGGAGGGAGG - Intergenic
943714302 2:191133504-191133526 GTATATATGCAGATGGAAGGTGG - Intronic
945567526 2:211420463-211420485 CTGGAAGTATAGATGGGAGGTGG + Exonic
946229298 2:218281910-218281932 CTGGAAGGGCAGATGGAAGGTGG - Intronic
947453978 2:230236242-230236264 CTGTAACTGCAAAAGGAGGGTGG - Intronic
948755034 2:240154711-240154733 CTGTAGGTGCAGAGGGCTGGGGG + Intergenic
948931869 2:241137199-241137221 CTTTAAGCTCAGAGGGAAGGTGG + Exonic
1168855716 20:1006296-1006318 CTGGAAGTGGAGAGGGAGGGTGG - Intergenic
1169138749 20:3214242-3214264 CTGTAAGTGGAGATGGTAAAGGG + Intronic
1169808664 20:9585710-9585732 TTGTAGCTGCAGATAGAAGGAGG + Intronic
1170140922 20:13124292-13124314 CTGGAAGGAAAGATGGAAGGGGG + Intronic
1171384661 20:24762428-24762450 CTGTGAGTGAAGATGTAAGTTGG - Intergenic
1172203541 20:33145670-33145692 CTTTAAGTGAACATGGATGGTGG - Intergenic
1172392677 20:34576523-34576545 CTGGATTTGCAGCTGGAAGGGGG - Intronic
1173297145 20:41769790-41769812 ATGGAAGTGCAGGTGGAATGTGG - Intergenic
1173589737 20:44215315-44215337 TTTCAAGTGCAGATGAAAGGAGG + Intergenic
1174452937 20:50630922-50630944 CTGTAGGTGTTGGTGGAAGGTGG - Intronic
1175370143 20:58482861-58482883 CTGTAAGTGCAGATGGAAGGAGG - Intronic
1175741571 20:61423224-61423246 CTGCAAGTGAAGCTGGCAGGAGG + Intronic
1176933231 21:14838909-14838931 CTGTAAGACCAGAAGGAAGGTGG + Intergenic
1177069785 21:16490226-16490248 CTCTGAGTGCTTATGGAAGGAGG - Intergenic
1178894878 21:36549950-36549972 CTGTGATTGCAGCTGGAATGAGG + Intronic
1179476612 21:41650642-41650664 CTGGAAGTGAAGATGGAACCAGG - Intergenic
1180699377 22:17773393-17773415 CTGTGGGTGGAGATGGAATGTGG + Intronic
1181573824 22:23781730-23781752 CTGTGAGTGCAGCTGGGAAGAGG + Intronic
1181746648 22:24959697-24959719 CTGTACGAGAAGAAGGAAGGGGG + Intronic
1183174427 22:36212499-36212521 CTGTAAGTGCAGCAGCAAGGAGG - Intergenic
1183178210 22:36239664-36239686 CTCTAAGTGCAGCAGCAAGGAGG - Intronic
1183313042 22:37121758-37121780 CTGAAAGTGTAGAATGAAGGGGG + Intergenic
1183330640 22:37219036-37219058 CAGCAAGAGCAGATGGAGGGTGG - Intergenic
1185106639 22:48874045-48874067 CTGAAAATGCAGATTGAAGAAGG - Intergenic
949426194 3:3918729-3918751 CTGTAAGAGCAGAGTGAAGCAGG + Intronic
950109823 3:10411910-10411932 CTGGAAATGCAGATGGTGGGTGG - Intronic
950870276 3:16222401-16222423 ATGTAAGAGCAGGTGGAATGTGG + Intronic
952732093 3:36649373-36649395 CTGTAATAACAGATGGAATGAGG - Intergenic
953271389 3:41448641-41448663 CTGTAAGGGCAGGAGGATGGTGG + Intronic
954280353 3:49572868-49572890 CTGTGTGTGCAGAAGAAAGGAGG + Intronic
955510802 3:59678543-59678565 CTGAAAGTGGTGATGGCAGGGGG - Intergenic
955817234 3:62858154-62858176 TTGGAAGTCCAGATGAAAGGTGG + Intronic
957374358 3:79336793-79336815 CTGTGAAAGCAGCTGGAAGGGGG + Intronic
957496635 3:81000066-81000088 CTGTATGAGCAGATTGAATGAGG - Intergenic
959608375 3:108266819-108266841 TTGTATGTGCTGACGGAAGGTGG - Intergenic
959966304 3:112359454-112359476 TTGTAAGTGGGGATGAAAGGAGG + Intronic
960127438 3:114015546-114015568 CTGTAAATGCAGACAGAAAGGGG + Intronic
960949180 3:122987980-122988002 AAGGAAGTGCAGTTGGAAGGGGG + Intronic
961810702 3:129520008-129520030 CTGGAAGGGGAGATGGGAGGGGG - Intronic
963295095 3:143537468-143537490 CTGAAATTGCAGGTGGCAGGTGG - Intronic
965906577 3:173714981-173715003 CATAAAGAGCAGATGGAAGGAGG + Intronic
966509810 3:180749322-180749344 CTTTAAGAGCAGAAGGAGGGTGG + Intronic
966721965 3:183072382-183072404 CTCTAATTGCAGATGGAGGAGGG + Exonic
968646162 4:1741629-1741651 CTGCAGGTGCAGCTGGAAGAGGG + Intronic
968687559 4:1971643-1971665 CTGTATGTGAACATGGGAGGAGG + Intronic
969401161 4:6956591-6956613 CTCTAATTGCAGATGAAAGGAGG + Intronic
973538206 4:51906017-51906039 GTGAAAGGGAAGATGGAAGGAGG + Intronic
974247092 4:59333849-59333871 GTGGAAGAGCAGAAGGAAGGAGG - Intergenic
974677903 4:65119042-65119064 CTGTTAGTGCAAATGTAAAGTGG - Intergenic
974694768 4:65352015-65352037 CTGTAACAGCAGATGGGAGACGG + Intronic
976786469 4:88826986-88827008 CTGTAAGTGGGGAAGGAAGAGGG - Intronic
978085922 4:104654140-104654162 CTGAAATTACATATGGAAGGAGG + Intergenic
979699970 4:123656443-123656465 CTGTGAAAGCAGCTGGAAGGAGG - Intergenic
981161427 4:141503780-141503802 CAGTGAGTGCAGGTGGAAAGAGG - Intergenic
982085872 4:151835710-151835732 CTGAAAATGCAGATGCCAGGAGG + Intergenic
982245814 4:153349314-153349336 GTGGAAGAGAAGATGGAAGGGGG - Intronic
982761471 4:159289457-159289479 CTATAATTGCTGATGGAAGGGGG + Intronic
984237555 4:177179060-177179082 CAGGAAGAGCAGATGGAAGATGG - Intergenic
984758592 4:183345144-183345166 CTGGAAATGCTGATGCAAGGGGG - Intergenic
985482122 5:119896-119918 GAGTAAGTGGAAATGGAAGGAGG + Intergenic
986040311 5:3987892-3987914 ATGGAAGGGCAGATGGAAGAAGG + Intergenic
986572463 5:9179805-9179827 CTGTAAGAGCAGATGCAGTGTGG + Intronic
986928686 5:12792363-12792385 CTGTAAGTGTGGATGGTATGGGG + Intergenic
987129156 5:14844620-14844642 CTGTAATTGCAACTGGAAGGTGG + Intronic
987365354 5:17143679-17143701 CTGTAAATGCATGTGGCAGGAGG - Intronic
988933470 5:36059996-36060018 CTGAATGTGAAGATGGAATGAGG + Intronic
989740233 5:44762375-44762397 CTGCATGTGCAGGTGGAATGTGG - Intergenic
991469759 5:66955344-66955366 CTGTAAGTGCAAAGGGCAAGAGG + Intronic
993282309 5:85940379-85940401 CTGCAATTGAAAATGGAAGGTGG - Intergenic
995450084 5:112290940-112290962 CTGTAATTGCAGATGAGAAGGGG - Intronic
996523391 5:124451495-124451517 AGGGAAGTGGAGATGGAAGGAGG + Intergenic
998161255 5:139814153-139814175 GGGTCACTGCAGATGGAAGGTGG - Exonic
998745635 5:145256203-145256225 CTGGATTTGAAGATGGAAGGAGG - Intergenic
1000411417 5:160937729-160937751 CTGCAACTGCTGATGGAGGGAGG + Intergenic
1002713840 5:181212763-181212785 CTGTAAGAGCAGATGAAATTCGG - Intergenic
1003134450 6:3423566-3423588 CTGTAAGTTAAAAAGGAAGGAGG + Intronic
1003690258 6:8346709-8346731 CTGTGAAAGCAGCTGGAAGGGGG + Intergenic
1004581290 6:16956047-16956069 CTGTATGTGTAGGTGGAGGGAGG + Intergenic
1006700987 6:35972970-35972992 GGGTATGTGTAGATGGAAGGAGG - Intronic
1008033664 6:46723988-46724010 CTCAAAGTGGGGATGGAAGGTGG - Intronic
1008631407 6:53365936-53365958 CTGTAAGAGCAGTCAGAAGGAGG - Intergenic
1010630149 6:78189439-78189461 CTGTGAAGGCAGCTGGAAGGTGG - Intergenic
1011893580 6:92196734-92196756 CTGAAAGTGCAGATTGAAAAGGG + Intergenic
1012096830 6:94972766-94972788 CTGCCAGTGCAGCTGGAAGAAGG - Intergenic
1014049112 6:116931036-116931058 GTGAAAGTGCAGATGGAAAGAGG + Intronic
1015555768 6:134459842-134459864 CAGTGAGTGCAGAAGGAAGCGGG - Intergenic
1015951160 6:138554003-138554025 CAGTATGTCCAGATGGAGGGAGG + Intronic
1016179368 6:141125415-141125437 CTGTCAGTGTTGATGAAAGGCGG - Intergenic
1017336134 6:153262486-153262508 CTGTAAGTGCACATGGAGAGTGG - Intergenic
1017341604 6:153330656-153330678 CTGTATGTTCAGATGGAAGATGG + Intergenic
1017387419 6:153901870-153901892 CTTTAAGTGAACATGGACGGTGG + Intergenic
1018055428 6:160048147-160048169 CTGTCAGTGCAGAGGCACGGGGG + Intronic
1018745285 6:166757197-166757219 CTGCAAGTGCAGAAGCAAAGGGG - Intronic
1019844159 7:3480237-3480259 CTGGCTGTGAAGATGGAAGGGGG + Intronic
1020444555 7:8255675-8255697 TTGAGAGTGCAGATGGAAAGAGG - Intronic
1021310555 7:19090667-19090689 CTGCAAGTGCAGCTGGAATAAGG - Intronic
1021793175 7:24226976-24226998 CTCTATGTGCAGGTGGCAGGTGG - Intergenic
1022047948 7:26638343-26638365 CGAGAAGTGCAGAGGGAAGGAGG - Intronic
1022343770 7:29493736-29493758 CTGGCAGTGGAGATGGAAAGTGG - Intronic
1022647110 7:32241879-32241901 ATGTGAGTGCAGATGCAGGGAGG + Intronic
1024663484 7:51521675-51521697 CTGTAAGTGGGGCTGGCAGGTGG + Intergenic
1027987263 7:85309144-85309166 CTGTTAGTGCAGACAGAAAGAGG - Intergenic
1028604441 7:92640246-92640268 ATCAAAGTGCAAATGGAAGGGGG + Intronic
1028669360 7:93383551-93383573 CTGTAACGGCAAATGTAAGGAGG - Intergenic
1029630246 7:101745767-101745789 ATCTAAGGGCAGATGGAAGAGGG + Intergenic
1030739899 7:113096288-113096310 CTGTTAGTGGAGATGTAAAGTGG + Intergenic
1031300848 7:120059702-120059724 CTGCAAGGGCTGAGGGAAGGTGG - Intergenic
1032642362 7:133783983-133784005 CTTTAAGAGCAGAAGGATGGGGG - Intronic
1033435803 7:141332630-141332652 CAGTATGTGCATATGGGAGGAGG + Intronic
1033930060 7:146509311-146509333 CTGCAATTGCTGATGGAGGGAGG + Intronic
1035352060 7:158253982-158254004 CTGAACGTGGAGATGGAGGGCGG - Intronic
1035352074 7:158254056-158254078 CTGAACGTGGAGATGGAGGGCGG - Intronic
1035352088 7:158254130-158254152 CTGAACGTGGAGATGGAGGGCGG - Intronic
1035352120 7:158254281-158254303 CTGAACGTGGAGATGGAGGGCGG - Intronic
1035352135 7:158254355-158254377 CTGAACGTGGAGATGGAGGGCGG - Intronic
1035352167 7:158254503-158254525 CTGAACGTGGAGATGGAGGGCGG - Intronic
1035352196 7:158254651-158254673 CTGAACGTGGAGATGGAGGGCGG - Intronic
1035689659 8:1551678-1551700 GCGTGAGTGCAGATGGAATGAGG - Intronic
1036426420 8:8649130-8649152 CTGTTAGTGCACATGGCAGCGGG + Intergenic
1036799712 8:11781266-11781288 CTGGAAGTTCAGAAGGAGGGTGG + Intronic
1038659189 8:29482071-29482093 CAGTGAGTGCAAATGGAAGGTGG + Intergenic
1038676490 8:29627575-29627597 ATGTAAGAGCAGATGGGATGAGG - Intergenic
1040138464 8:43882671-43882693 CTCTTAGGGCAGATGGGAGGGGG + Intergenic
1040582946 8:48712302-48712324 TTGGAAATGCAGATGGGAGGTGG + Intronic
1041193056 8:55372905-55372927 CTGTCAGAGCAGATGCAAGGGGG + Intronic
1041732402 8:61075853-61075875 ATGTAAGGGAAGAAGGAAGGAGG - Intronic
1042755156 8:72202482-72202504 CTGTGAGAGCAGATGGGTGGGGG - Intergenic
1043089997 8:75888485-75888507 CTGTACGTGCATATGAAATGAGG + Intergenic
1044256156 8:90064743-90064765 TTGTAAGTGGAGATGTAATGAGG + Intronic
1044738584 8:95303228-95303250 CTGTAACTCCACATGGCAGGAGG + Intergenic
1047368873 8:124238357-124238379 CTGTATGTGAGGAGGGAAGGTGG - Intergenic
1047502755 8:125454622-125454644 GGGTAAGGGCAGATGGAAGGAGG + Intergenic
1047529348 8:125661001-125661023 CTGAAAGTGGAACTGGAAGGGGG + Intergenic
1048520658 8:135151330-135151352 CTGTAAGTGGAAATGGTGGGTGG - Intergenic
1049140250 8:140948092-140948114 CTGTAAGTGTATAGGGAAGCAGG - Intronic
1051339791 9:16100834-16100856 CTGTTGGGGCAGATGGGAGGGGG + Intergenic
1054990187 9:71316588-71316610 CTGTCTTTGAAGATGGAAGGAGG + Intronic
1056974241 9:91236066-91236088 CAGGAAGTACAGATGGATGGAGG + Intronic
1057065789 9:92049756-92049778 TTATAAGTGCAGAAGGAAGATGG + Intronic
1057141166 9:92727611-92727633 CTGCAAGTGGAGCTGGAAGTTGG - Intronic
1058090953 9:100804752-100804774 CTGGATTTGAAGATGGAAGGAGG + Intergenic
1058776489 9:108289318-108289340 CTGGAGAAGCAGATGGAAGGGGG - Intergenic
1060398819 9:123335500-123335522 CTGTGAGGGCAGAGGGCAGGTGG - Intergenic
1060509570 9:124222253-124222275 CTGGAAGGGCAGATGGGAGTGGG - Intergenic
1185870623 X:3662177-3662199 CTGTAAGACCAGGTAGAAGGTGG + Intronic
1187225786 X:17374923-17374945 CAGTAAGCGCAGAGGGAAGAGGG - Intergenic
1188427168 X:30062314-30062336 CTGTAACTACAGAGTGAAGGTGG + Intergenic
1190182191 X:48202365-48202387 CTAAAATTGCAGATGGGAGGAGG + Intronic
1190183159 X:48211211-48211233 CTGTAAGTGGAGAAGGAGGGAGG + Intronic
1190813337 X:53906320-53906342 CTGCAAGTGGAGATGAAAGAAGG + Intergenic
1192890042 X:75380729-75380751 GTATAGGTGCAGATGGTAGGAGG - Intronic
1194128446 X:90049113-90049135 ATGTAGGTGTAGATGGAAGAGGG - Intergenic
1196712905 X:118781882-118781904 AAATAAGTGCAGATGGCAGGAGG - Intronic
1197323153 X:125058749-125058771 CTGTAATTGCAAGTGGAATGGGG + Intergenic
1198700527 X:139392651-139392673 GTGTGTGTGCACATGGAAGGAGG - Intergenic
1199382063 X:147182635-147182657 TTCTGAGTGCAGAAGGAAGGAGG + Intergenic
1199533089 X:148871542-148871564 ATGTGAGGGCTGATGGAAGGAGG - Intronic