ID: 1175371514

View in Genome Browser
Species Human (GRCh38)
Location 20:58495946-58495968
Sequence CAGGCCAAGGATGGGGGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 648
Summary {0: 1, 1: 0, 2: 3, 3: 72, 4: 572}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175371514_1175371526 -3 Left 1175371514 20:58495946-58495968 CCACATCCCCCATCCTTGGCCTG 0: 1
1: 0
2: 3
3: 72
4: 572
Right 1175371526 20:58495966-58495988 CTGAGTTACAGAGGGGGCGGTGG 0: 1
1: 0
2: 2
3: 17
4: 269
1175371514_1175371524 -6 Left 1175371514 20:58495946-58495968 CCACATCCCCCATCCTTGGCCTG 0: 1
1: 0
2: 3
3: 72
4: 572
Right 1175371524 20:58495963-58495985 GGCCTGAGTTACAGAGGGGGCGG 0: 1
1: 0
2: 0
3: 27
4: 301
1175371514_1175371523 -9 Left 1175371514 20:58495946-58495968 CCACATCCCCCATCCTTGGCCTG 0: 1
1: 0
2: 3
3: 72
4: 572
Right 1175371523 20:58495960-58495982 CTTGGCCTGAGTTACAGAGGGGG 0: 1
1: 1
2: 1
3: 31
4: 208
1175371514_1175371529 26 Left 1175371514 20:58495946-58495968 CCACATCCCCCATCCTTGGCCTG 0: 1
1: 0
2: 3
3: 72
4: 572
Right 1175371529 20:58495995-58496017 TTGAGGCCCTACCCCATTGAGGG 0: 1
1: 0
2: 1
3: 3
4: 75
1175371514_1175371522 -10 Left 1175371514 20:58495946-58495968 CCACATCCCCCATCCTTGGCCTG 0: 1
1: 0
2: 3
3: 72
4: 572
Right 1175371522 20:58495959-58495981 CCTTGGCCTGAGTTACAGAGGGG 0: 1
1: 0
2: 2
3: 21
4: 166
1175371514_1175371528 25 Left 1175371514 20:58495946-58495968 CCACATCCCCCATCCTTGGCCTG 0: 1
1: 0
2: 3
3: 72
4: 572
Right 1175371528 20:58495994-58496016 CTTGAGGCCCTACCCCATTGAGG 0: 1
1: 0
2: 1
3: 19
4: 199
1175371514_1175371527 9 Left 1175371514 20:58495946-58495968 CCACATCCCCCATCCTTGGCCTG 0: 1
1: 0
2: 3
3: 72
4: 572
Right 1175371527 20:58495978-58496000 GGGGGCGGTGGCTGCGCTTGAGG 0: 1
1: 0
2: 4
3: 41
4: 457

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175371514 Original CRISPR CAGGCCAAGGATGGGGGATG TGG (reversed) Intronic
900274572 1:1815914-1815936 CTTGACAAGGATGGGTGATGAGG - Intronic
900331798 1:2138558-2138580 CAGCCCAGGAATGGGGGGTGAGG + Intronic
900459769 1:2797294-2797316 CTGGCCTGGGATGGGGGCTGGGG + Intronic
900602397 1:3508767-3508789 CAGGCCAGGGAAGGGGCATAAGG + Intronic
900809961 1:4794424-4794446 CAGGTGAGGGATGGGGAATGGGG - Intergenic
900975122 1:6011951-6011973 CTGGCCTAGGATGGTGGAGGTGG + Intronic
901142155 1:7042263-7042285 CAGCCCAGGGAAGGGGGACGAGG - Intronic
901628120 1:10635017-10635039 CAGCCCAAGGAAGGGGAACGGGG - Intergenic
901737539 1:11321992-11322014 CAGCAGAAGGATGGAGGATGGGG - Intergenic
901759038 1:11458899-11458921 CAGGCCCAGGAGGGGGCAGGAGG - Intergenic
901760590 1:11468838-11468860 CAGGCCAGGGCTGGGGTACGGGG - Intergenic
902511127 1:16967579-16967601 CAGGCTCAGGATAGGGGCTGGGG + Intronic
902551112 1:17220114-17220136 AAGGCCAGGAGTGGGGGATGGGG + Intronic
902681771 1:18048819-18048841 CAGTCCAGGGCTGGGGGAGGTGG - Intergenic
902747817 1:18484894-18484916 CAGGCCAGGGAAGTGGGGTGGGG - Exonic
902809577 1:18880471-18880493 CAGGGGAGAGATGGGGGATGTGG - Intronic
902987224 1:20162277-20162299 CAGGCTTAGGGTGGGGGATAGGG - Intronic
903005010 1:20292745-20292767 CCAGCCAAGGCTGGGTGATGAGG - Intronic
903033191 1:20477697-20477719 CTCCCCCAGGATGGGGGATGAGG - Intergenic
903185230 1:21625045-21625067 CAGCCCAAGACTGGGGCATGTGG - Intronic
903328679 1:22585990-22586012 CAGGCCAGGGATGGGGGTGCTGG - Intronic
903441390 1:23390568-23390590 CAAGTCAAGCATGGGAGATGTGG + Intronic
903471679 1:23591843-23591865 CAGGCCAAGCCTGGGGGTGGGGG + Intronic
903811791 1:26038778-26038800 CAGGCTGAGAATGGGGCATGAGG + Exonic
903874641 1:26465077-26465099 CAGGCCAGGGAGGGGGTGTGCGG + Intronic
903994746 1:27298760-27298782 CTGGCCCTGGCTGGGGGATGGGG - Intronic
904466993 1:30714185-30714207 CAGGCCAGTGTTGGGGGAGGCGG - Intronic
904492995 1:30871765-30871787 CAGGGCAGGGAGGGGGCATGTGG - Intronic
904914619 1:33960927-33960949 CAGGAAAAGGATGGGAGATGTGG - Intronic
905261141 1:36719999-36720021 CAGATCAAGGGTCGGGGATGGGG - Intergenic
905799125 1:40832218-40832240 GTGCACAAGGATGGGGGATGGGG + Intronic
906480583 1:46196940-46196962 TAGGCTAAGGATGGGGTAGGGGG - Intronic
906537668 1:46560605-46560627 CAGGCCCGGGATGGGGAGTGGGG + Intronic
906687047 1:47769546-47769568 CAGGCCCAGGAGGTGGGCTGGGG - Intronic
907253593 1:53160963-53160985 CAGGCCAGAGATTGGAGATGAGG + Intergenic
907763806 1:57388547-57388569 GAGGCCCAGGAGAGGGGATGGGG - Intronic
910333337 1:86100856-86100878 AAGGCAAAGAATTGGGGATGGGG - Intronic
912078518 1:105909051-105909073 TAGGCACAGGATGGGGGACGGGG - Intergenic
912138517 1:106692065-106692087 CAGGGTAAGGAGGGGGAATGAGG + Intergenic
912491539 1:110065241-110065263 AAGGCCAAGAATGGGGGCAGAGG + Intronic
912724353 1:112045466-112045488 CTGGGCAAGGGTTGGGGATGCGG - Intergenic
912744454 1:112233585-112233607 TATACCAAGGATGGAGGATGGGG + Intergenic
913133393 1:115863583-115863605 CAGGTAAAGGTTTGGGGATGTGG + Intergenic
913319761 1:117579993-117580015 CAGGCCCAGGCTGGGGCCTGTGG + Intergenic
913534399 1:119757455-119757477 GAAGGCAAGGATGGGGCATGAGG + Intronic
914001521 1:143698690-143698712 CTGGCAATGGATGTGGGATGTGG + Intergenic
915299932 1:154946092-154946114 CAGGCCAAGGGTGGAGGAGTCGG - Exonic
915311148 1:155006410-155006432 CAGGCAAAGGAAGGGGTTTGGGG - Intronic
915526053 1:156476976-156476998 TGGGCCAAGGGTGGGGGCTGGGG - Intronic
915973160 1:160367850-160367872 CAGCCCCAGCATGGGGGGTGGGG + Intronic
916442037 1:164836653-164836675 CAGGCCCAGGCTTGGGGGTGGGG - Intronic
916844775 1:168638494-168638516 CAGCCCAGGGATGGAGGTTGAGG + Intergenic
918143078 1:181734458-181734480 CAGGGCAGGGATGGGGTATGGGG - Intronic
918143098 1:181734533-181734555 CAGGGCAGGGATGGGGTATGGGG - Intronic
918143140 1:181734683-181734705 CAGGGCAGGGATCGGGTATGGGG - Intronic
918143161 1:181734758-181734780 CAGGGCAGGGATGGGGTATGGGG - Intronic
918143203 1:181734908-181734930 CAGAGCAGGGATGGGGTATGGGG - Intronic
918312340 1:183293647-183293669 CAGGCCAGGGATGGGGGGACGGG + Intronic
919827237 1:201512052-201512074 CAGGCCAAGGGGAGGGGAAGAGG - Intergenic
920017696 1:202927002-202927024 GAGACCAAGGATGGGGGGTAGGG + Intronic
920106389 1:203556326-203556348 AAGTCCAGGGTTGGGGGATGGGG + Intergenic
920215365 1:204358816-204358838 CAGGGCAGGGAAGGGGGCTGTGG - Intronic
920435090 1:205942333-205942355 CAGGGCCAGGATGAGGGAGGTGG + Intronic
921592487 1:217021024-217021046 CATGGCAGGGTTGGGGGATGGGG - Intronic
921628382 1:217403388-217403410 CAGGCAGAGAAAGGGGGATGGGG + Intergenic
924200733 1:241655907-241655929 CAGGCCAATGGTGGAGGATAAGG - Intronic
924521440 1:244809617-244809639 GAGGCCAAGGCGGGTGGATGAGG - Intergenic
924841303 1:247712258-247712280 CAGGCCACTGATGAGGGCTGTGG + Exonic
924940286 1:248808593-248808615 CAGTACAGGAATGGGGGATGGGG + Intergenic
1063075379 10:2711331-2711353 TAGGTCAAGGAGGGGTGATGTGG - Intergenic
1063320042 10:5044226-5044248 AAGGCCAAGGCTGGGAGTTGGGG + Intronic
1063384233 10:5606114-5606136 CAGGCCCAGGACTGGAGATGAGG + Intergenic
1063679674 10:8175030-8175052 CGGGCCACGGGTGGGGGAAGTGG + Intergenic
1064066235 10:12184296-12184318 GAGGCCAAGGGTGGGGGCCGGGG - Intronic
1064720600 10:18225232-18225254 CTGGCAGAGGATGGGGGATGGGG + Intronic
1065077685 10:22097696-22097718 CAGACCAAGGATGGGGAGGGAGG - Intergenic
1066099839 10:32107980-32108002 CATGGCAAGGATGGGCGCTGTGG + Intergenic
1069567271 10:69472186-69472208 CAGGCAGAGGATGAGGGAAGGGG - Intronic
1069610295 10:69768269-69768291 CAGGCAAAGGCTGGGGGCTGAGG + Intergenic
1069683463 10:70301255-70301277 GAGGCCAAGCCTGGGGGCTGGGG - Exonic
1069819033 10:71216462-71216484 GAGGCCAATGCTGGGGGTTGGGG - Intronic
1069960201 10:72075004-72075026 CAGGTCAAGCCTGAGGGATGGGG - Intronic
1070779568 10:79129770-79129792 CAGGCCAGGGCTGGGGGCAGGGG - Intronic
1071328399 10:84538803-84538825 CAGGCCAGGGATTGGGGTGGGGG + Intergenic
1071570508 10:86694225-86694247 AAGGCCAAGGATGAGGCCTGGGG - Intronic
1073474742 10:103745599-103745621 CAGGTCAAGGAGGTGGGATGGGG + Intronic
1074164808 10:110865785-110865807 TAGGCCAAGTATAGGAGATGTGG + Intergenic
1074298006 10:112209021-112209043 AAGGACAGGGATTGGGGATGGGG + Intronic
1074907206 10:117875242-117875264 CAGGCCAGGGATGGGACAAGAGG - Intergenic
1075484924 10:122814217-122814239 CAGGCCAAGCAGGAGAGATGTGG - Intergenic
1075484942 10:122814295-122814317 CAGGCCAAGCAGGAGAGATGGGG - Intergenic
1075630392 10:123997159-123997181 GAGGCCAGGGCTGGGGGCTGGGG + Intergenic
1076204794 10:128588537-128588559 AATGAAAAGGATGGGGGATGGGG - Intergenic
1076372971 10:129966906-129966928 CAGGCCAGGGATGGGGAAGGGGG + Intergenic
1076707161 10:132308180-132308202 CAGTCTAGGGATGGGGGCTGTGG + Intronic
1076847194 10:133075133-133075155 CAGGCCAGGGCTGGGGCCTGAGG - Intronic
1077177320 11:1196731-1196753 CAGGCCGGGGCTGGGGGGTGTGG + Intronic
1077207180 11:1350226-1350248 CAGGCCAACCCTGGGGGAGGTGG - Intergenic
1077289748 11:1783565-1783587 CCAGCCAGGGATGGGGGCTGTGG - Intergenic
1079513461 11:21238534-21238556 GAGGCACAGGTTGGGGGATGTGG + Intronic
1080173728 11:29337444-29337466 CAGGGCAAGGGTGGAGGCTGTGG + Intergenic
1080778703 11:35410646-35410668 CAGGGCAAGGCTTGGGGTTGGGG - Intronic
1081773672 11:45664404-45664426 CAGGCCCGGGGTGGGGGAGGGGG + Intronic
1082165656 11:48947393-48947415 GAGGCCAGGGACTGGGGATGAGG + Intergenic
1082237555 11:49837597-49837619 GAGGCCAGGGACTGGGGATGAGG - Intergenic
1082610929 11:55296561-55296583 GAGGCCAGGGACTGGGGATGAGG - Intergenic
1082658999 11:55887128-55887150 GAGGCCAGGGACTGGGGATGAGG + Intronic
1082989519 11:59195291-59195313 CAGGCAAGGAGTGGGGGATGAGG - Exonic
1083171601 11:60926727-60926749 CATGGCAATGATGGGGGAGGAGG + Intronic
1083191103 11:61052943-61052965 CAGGCCATGGTTGGGAGATGGGG - Intergenic
1083214292 11:61208767-61208789 CGGGCCAAGGATGAGGGAAGTGG - Intronic
1083217176 11:61227596-61227618 CGGGCCAAGGATGAGGGAAGTGG - Intronic
1083654662 11:64223673-64223695 CAGGCCAGGGATGGGGGTGGGGG + Exonic
1083804999 11:65068186-65068208 GATGGCAAGGATGGGGGGTGTGG - Intronic
1084006692 11:66326938-66326960 TAGGCCAAGGGTGGGGGCAGGGG - Intergenic
1084212878 11:67631936-67631958 CAGGCCTGGGATGAGGGATGAGG - Intronic
1084601754 11:70149922-70149944 CAGGCAGGGGGTGGGGGATGGGG - Intronic
1084804804 11:71571488-71571510 CAGGCCAGGGATGGAGGAGCGGG + Intergenic
1084805651 11:71577035-71577057 CAGGCCAGGGATGGAGGAGCGGG - Intergenic
1085625801 11:78071886-78071908 CAGGCAAATGATGAGTGATGAGG + Intronic
1085782212 11:79419762-79419784 CAGGCCAAGGAGTGGAGATGTGG - Intronic
1086371096 11:86156547-86156569 CAGGCTAGGGCTGGGGGCTGGGG - Intergenic
1086961391 11:92982632-92982654 GAGGCCAAGGCAGGAGGATGAGG - Exonic
1088833667 11:113559394-113559416 CAGGCCAAAGATGGGGGCTAAGG + Intergenic
1089293713 11:117455341-117455363 CAGGCAAAGGGTGGGTAATGAGG - Intronic
1089558811 11:119332998-119333020 GAGGCCAAGGGTGGAGGAAGTGG + Intergenic
1089625215 11:119746827-119746849 GAGGCCAAGGGTGGGGGGGGGGG + Intergenic
1090136071 11:124200567-124200589 GAGGCCAAGGCTGGTGGATTAGG + Intergenic
1090746680 11:129710871-129710893 CAAGCCAAGGCTGAGGGAGGGGG + Intergenic
1091282536 11:134390229-134390251 CAGGCTAAATCTGGGGGATGTGG - Exonic
1091691124 12:2598240-2598262 CAGGCAAGGGCTGGGGGCTGGGG - Intronic
1091745865 12:2992502-2992524 CAGGCCATGGGTGGGAGATGAGG + Intronic
1091829941 12:3542416-3542438 CAGGCCAAGGATGGGGCTCCAGG - Intronic
1091878880 12:3960399-3960421 CAGGCCAAGGATGGGAGGAATGG - Intergenic
1092116491 12:6012416-6012438 CACGCCAGGGATGGGGAAGGTGG + Intronic
1092230827 12:6774378-6774400 CAGGCCAGGGACGGGGAAAGTGG + Intronic
1095957903 12:47817197-47817219 CAGGCCAAGGCTGGAGAAGGAGG - Intronic
1096262771 12:50103488-50103510 CAGGGCTGGGGTGGGGGATGTGG - Intergenic
1096530471 12:52239524-52239546 CAGGCTAAGGATTCGGGAGGAGG + Intronic
1096835793 12:54350410-54350432 CAGGGTAAGGATGAGGGCTGGGG - Intronic
1097038062 12:56137145-56137167 CAGGCAAAGCATGTGGGGTGGGG - Intronic
1097097549 12:56561756-56561778 GAGGCCAAGGAGGGGGGGGGTGG - Intronic
1097166190 12:57087843-57087865 CAGGGAAAGGAGGGGGGGTGGGG - Intronic
1097174656 12:57135813-57135835 CAGGCCAAAAATGGGGGTGGGGG + Intronic
1097288794 12:57896970-57896992 CATCCCGGGGATGGGGGATGGGG - Intergenic
1098377823 12:69836306-69836328 TAGGCACAGGATGGGGGACGTGG + Intronic
1099371022 12:81829838-81829860 AAGGTCAGGTATGGGGGATGGGG - Intergenic
1100604034 12:96136346-96136368 CATGCCAAGAATGCGGGCTGGGG - Intergenic
1100894317 12:99162524-99162546 CAGGACAAGAATGGAGGAAGGGG - Intronic
1101014649 12:100487489-100487511 CAGGACAGGGGTGGGGAATGGGG + Intronic
1101914183 12:108883656-108883678 GAGGCAAAGTATGGGGGAAGAGG + Intronic
1102011898 12:109624104-109624126 CAGGCCACAGAAGGGGGCTGAGG + Intergenic
1102512493 12:113425231-113425253 GAGGCCTAGGCTGGGGTATGCGG + Intronic
1102635747 12:114322110-114322132 AGGGCCAGGGATGGGGTATGAGG - Intergenic
1102886845 12:116528596-116528618 CAACCCAAGAGTGGGGGATGGGG - Intergenic
1103344476 12:120240265-120240287 CAGGTGACAGATGGGGGATGAGG + Intronic
1104000128 12:124854971-124854993 CACCCCAGGGATGAGGGATGAGG + Intronic
1104120827 12:125798068-125798090 CAGCCCTAGGACGTGGGATGTGG - Intergenic
1104568269 12:129903861-129903883 CCGGCCTGGGATGGGGGCTGCGG - Intergenic
1104754523 12:131260701-131260723 CAGGCCAGGGATTGGGGGTGAGG + Intergenic
1104891666 12:132143198-132143220 CAGGTCAAGGTTGGGGGTTGGGG - Intronic
1104939780 12:132389705-132389727 CAAGGCAAGGATGAGGGAAGGGG + Intergenic
1105202489 13:18192168-18192190 CAGGGGAAGGATGGGGACTGTGG - Intergenic
1106151976 13:27113358-27113380 CAGGCCCAGCATGGGGGACAGGG - Intronic
1106226174 13:27788962-27788984 CAGGCCTAGGAAGTGGGCTGGGG + Intergenic
1108004525 13:45933816-45933838 CAGGCCAAGGGTGGTGTGTGGGG + Intergenic
1109650260 13:65314464-65314486 CTGGCAATGGATGGGGAATGGGG - Intergenic
1112743438 13:102500816-102500838 TAGGCGAGGGTTGGGGGATGGGG - Intergenic
1113385290 13:109842788-109842810 CAGGCCCAGGAGTGGGGATGGGG - Intergenic
1113670149 13:112170751-112170773 CAGTCCCAGGTTGGGGGATGGGG - Intergenic
1113814870 13:113162983-113163005 CAGGAGGAGGATGGGGGTTGGGG - Intronic
1113940446 13:114016002-114016024 CAGGCCAAAGGTGGTGGCTGAGG + Intronic
1114165453 14:20213623-20213645 CAGGCCAGGGAAGTGGGGTGTGG - Intergenic
1115309570 14:31965650-31965672 CAGGCTCAGGATGGGGGTAGGGG - Intergenic
1115525762 14:34279299-34279321 GATGCCAAGGATGGGGGTGGTGG - Intronic
1115592574 14:34878639-34878661 GAGGCCAAGGCAGGTGGATGAGG + Intergenic
1115664869 14:35534947-35534969 CAGGCCCAGGACAGGGGATGTGG - Exonic
1116141549 14:41001639-41001661 GAGGCCAAGGAAGGCGGATCAGG - Intergenic
1116968940 14:51044613-51044635 CAGGCCAAGGATTGTGGACCAGG + Intronic
1118719497 14:68584070-68584092 CAGCCCCAGCATGGGGGGTGGGG - Intronic
1119668045 14:76498834-76498856 CAGGCCACAGATGGGGGAGGGGG - Intronic
1119705304 14:76779439-76779461 CAGGCCTGTGATGGGGGGTGGGG + Exonic
1120932173 14:89859776-89859798 CAGGCAGAGGAGGGGGCATGAGG + Intronic
1120986039 14:90335854-90335876 GAGGCCAAGGTGGGAGGATGAGG + Intergenic
1121437556 14:93929179-93929201 CAGGCCAGAGGTGGGGGCTGAGG - Exonic
1121449910 14:94000665-94000687 CAGGTCAAGCATGGGGCTTGCGG + Intergenic
1121921726 14:97888284-97888306 CAGGCCTGGGATGGTGGAGGTGG + Intergenic
1122309672 14:100786431-100786453 CATGCCAGGGATGTGGGATGGGG + Intergenic
1122355143 14:101118436-101118458 TGGGCCAGGGATGGGGGAGGAGG - Intergenic
1122437404 14:101709503-101709525 CAGGGCAGGGGTGGGGGATGGGG + Intergenic
1122719119 14:103712339-103712361 CAGGCCAAGGCAGGGCGGTGGGG + Intronic
1122765565 14:104066961-104066983 CAGGCCTGTGATGGGGGGTGCGG + Intergenic
1122955986 14:105071525-105071547 CAGGGCAAGGTATGGGGATGCGG + Intergenic
1123078515 14:105680872-105680894 GAGGCCAGGGACTGGGGATGGGG - Intergenic
1123678880 15:22741742-22741764 GAGGCCAAGGAGGGAGGATCAGG - Intergenic
1124331089 15:28816035-28816057 GAGGCCAAGGAGGGAGGATCAGG - Intergenic
1125796726 15:42409007-42409029 CAGGCCTGGGATGGTGGAGGGGG + Intronic
1127141300 15:55980349-55980371 CAGACCCAAGTTGGGGGATGAGG - Intronic
1127952044 15:63817733-63817755 CAATCCAAGGATTGGGGATGAGG + Intronic
1127969051 15:63944859-63944881 CAGGCAAGGGATGGGTGGTGAGG - Intronic
1128253541 15:66180412-66180434 CTGGCTCAGGATGGGGTATGGGG - Intronic
1128291384 15:66481045-66481067 GAGTGCAAGGAAGGGGGATGGGG + Intronic
1128978008 15:72167341-72167363 GAGGCCAAGGATGGTGGCTCTGG + Intronic
1129228550 15:74183818-74183840 CAGGCCAAGGCTGGGTGTGGCGG + Intronic
1129328749 15:74816151-74816173 CAGGCCCAGGATGGCGTCTGTGG - Exonic
1129674138 15:77623225-77623247 CAGGCCAAGGAAGAGGCAGGGGG + Intronic
1130128160 15:81111722-81111744 CAGGCAGAGGAAGGAGGATGAGG - Intronic
1130627080 15:85526701-85526723 CAGGGCCAGGCTGGGGGATGGGG - Intronic
1131394097 15:92073042-92073064 CGGGCAAAGGATGGGGGAAAGGG - Intronic
1132132119 15:99292098-99292120 CAGGCCAAGGATGGAGCAGCAGG - Intronic
1132571857 16:647719-647741 CAGGCCCTGGGTGGGCGATGGGG + Intronic
1132579374 16:678072-678094 CAGGCCAGGGCTCGGGCATGTGG + Exonic
1132618369 16:853169-853191 CAGGCCGAGGAGGGCGGCTGCGG - Intergenic
1132630560 16:915278-915300 CAGGCACAGGATGGGGGCAGAGG + Intronic
1132647152 16:1004373-1004395 CAGGCCCAGGAGTGGGGCTGGGG - Intergenic
1132888441 16:2192901-2192923 CAGGCAGAGTGTGGGGGATGAGG - Intronic
1133435259 16:5773971-5773993 CAGGCCAAGCATGGTGGCTCAGG - Intergenic
1133655904 16:7863483-7863505 CAGGTCAATGATTGGGGCTGGGG + Intergenic
1133785677 16:8971306-8971328 GAGGCCAAGGACGGCGGATCAGG - Intergenic
1133890919 16:9877815-9877837 CAGGACAGGGAGGGGGGATGGGG - Intronic
1135325100 16:21520825-21520847 GAGGCCAAGGATGGGGTTTGGGG + Intergenic
1135407249 16:22207044-22207066 CAGGGGAAAGGTGGGGGATGCGG - Intronic
1135462366 16:22655876-22655898 CAGGCCAGGAATGGGGGCTCAGG - Intergenic
1136240035 16:28937964-28937986 GGGGCTCAGGATGGGGGATGGGG - Intronic
1136336583 16:29614093-29614115 GAGGCCAAGGATGGGGTTTGGGG + Intergenic
1137609642 16:49810032-49810054 CAGGCCAAAGAGTGGGGAAGGGG - Intronic
1137830513 16:51539213-51539235 CAGGCACAGGATGGGGGAGAGGG + Intergenic
1139017813 16:62711481-62711503 TAGGCACAGGATGGGGGCTGTGG - Intergenic
1139483093 16:67241429-67241451 CAGGCCAAGGGAGGGAGATGCGG - Intronic
1142037307 16:87869877-87869899 GAGGCCAAGGATGGAGTTTGGGG + Intergenic
1142069899 16:88086386-88086408 CAATCCACGGATGCGGGATGGGG - Intronic
1142626786 17:1197372-1197394 CAGACCAAAAATGGGGCATGGGG - Intronic
1142640220 17:1281085-1281107 CATGCCCAGGAAGGGGCATGGGG + Intronic
1143713981 17:8753916-8753938 CATGACAAGGAAGGGGGGTGTGG - Intronic
1143776673 17:9204085-9204107 CAGTCCTAGGATCGGTGATGAGG + Intronic
1143875273 17:9986503-9986525 GGGCTCAAGGATGGGGGATGGGG - Intronic
1143876809 17:9997883-9997905 AGGGCCAGGGATGGGGGAAGGGG + Intronic
1143908291 17:10227074-10227096 GAGGCCCAGGTTGGGGGCTGCGG + Intergenic
1143970877 17:10794731-10794753 CAGAGCAAGGATGGGCGCTGTGG - Intergenic
1145399736 17:22521697-22521719 GAGGCCAAAGATGGGGGAAGGGG - Intergenic
1146384207 17:32354849-32354871 GAGGCCAAGGAAGGTGGATCAGG - Intronic
1146458007 17:33022053-33022075 CTGGCCCAGGATGGGGTCTGGGG + Intronic
1147132523 17:38417880-38417902 GAGGCCAAGGATGAGGGCTCCGG + Intergenic
1147159031 17:38560019-38560041 GAGAACAAGGATGGGGGAGGGGG + Intronic
1147361601 17:39934165-39934187 CAGGCACAGGCTGGGGGATGGGG - Intergenic
1148226719 17:45903366-45903388 CAGGCCATGGGAGGGGGATGAGG - Intronic
1148540015 17:48472857-48472879 CAGGCATGGGATGGGGGAAGAGG - Intergenic
1148624043 17:49055345-49055367 CAGGAATAGGGTGGGGGATGGGG - Exonic
1148755667 17:49971837-49971859 GAGGCCACGGGTGAGGGATGCGG + Intronic
1148799434 17:50213975-50213997 CAGGGCAGGGGTGGGGGATAGGG + Intergenic
1148821217 17:50360756-50360778 CAGGCCCAGAATGGGGCATGAGG - Exonic
1148970783 17:51479423-51479445 CAGGCCAAGGGGTGGGGGTGGGG - Intergenic
1149581045 17:57750518-57750540 CAAGGCTGGGATGGGGGATGGGG + Intergenic
1150677290 17:67255428-67255450 GAGGCCATGGCAGGGGGATGGGG - Intergenic
1151341545 17:73474442-73474464 CAGACCCAGGATGGAGGGTGGGG - Intronic
1151519599 17:74618719-74618741 CAGGCCAAGCATGGTTGGTGGGG - Intronic
1151890980 17:76950110-76950132 CAGGCCTAGGCTGGTGGGTGGGG - Exonic
1152518257 17:80838691-80838713 GAGGCCAGGGATGGGGGAGGCGG + Intronic
1152535810 17:80949792-80949814 CAAGCCAAGGATGAAGGTTGGGG - Intronic
1153703915 18:7725546-7725568 TAGGCACAGGATGGGGGTTGGGG - Intronic
1156475446 18:37402920-37402942 CAGGCCATGCATGGAGGGTGGGG - Intronic
1157589527 18:48828023-48828045 CAGTCAAAGGGTGGGGGCTGGGG - Intronic
1158440319 18:57469347-57469369 CAGGGCAAGGGTGGGGAGTGGGG - Intronic
1158690744 18:59657991-59658013 CAGGCCAAGAGTGTGGGCTGAGG + Intronic
1160273727 18:77411029-77411051 CTGGCAGAGGTTGGGGGATGTGG - Intergenic
1160557837 18:79737629-79737651 AAGGACATGCATGGGGGATGCGG - Intronic
1161352800 19:3803342-3803364 CAGGCCAAAGGAGGGGGGTGGGG - Intergenic
1161718908 19:5892570-5892592 CATGGGAAGGAAGGGGGATGAGG + Exonic
1161961577 19:7526391-7526413 CATGGCTAGGATGGGGGTTGGGG - Intronic
1161979403 19:7622732-7622754 CAGGCCCAGGCTGTGGGGTGGGG - Intronic
1162459996 19:10809323-10809345 CAGGCCAAGGATAGGAGAAAGGG - Intronic
1162753510 19:12843425-12843447 CAGGGCCAGGGTGGGGGTTGGGG - Intronic
1162765726 19:12918358-12918380 GAGGCCAAGGAGGGAGGATGAGG + Intronic
1163566147 19:18052315-18052337 CAGGCCAGAGGTGGGGGCTGGGG + Intergenic
1163728951 19:18938938-18938960 CAGGGCCAGGCTGGGGGAGGTGG + Intronic
1164563474 19:29309856-29309878 CAGGACAAGGGTAGGGGCTGGGG - Intergenic
1164591945 19:29512202-29512224 AGGGCGAAGGAGGGGGGATGAGG + Intergenic
1165258401 19:34593729-34593751 CTGGACAAAGATGGTGGATGTGG + Intronic
1165334093 19:35156929-35156951 CAGGACCAGGATGGGGGCAGTGG + Intronic
1165956027 19:39502783-39502805 CAGGCAAAGGAGGGGTGCTGGGG - Intronic
1166200027 19:41231352-41231374 CAGGGAGAGGATGGGGGTTGTGG - Intronic
1166259158 19:41626044-41626066 CACTCCAAGGCTGAGGGATGAGG - Intronic
1166712467 19:44945970-44945992 TAGACAAAGGATGGGGGTTGTGG + Exonic
1167294075 19:48639270-48639292 CAGGCCTAGGAAGGGCGGTGCGG + Intronic
1167308953 19:48725347-48725369 CAGGCCAAGGACAGGAAATGAGG + Intronic
1167448542 19:49553880-49553902 GAGGACAAGGATTAGGGATGTGG + Intergenic
1167457748 19:49606555-49606577 GAGGCCAAGGTTGGGGGGCGGGG - Intronic
1167605644 19:50480257-50480279 CAGGACCAGGGTAGGGGATGAGG - Intronic
1167705433 19:51078790-51078812 AAGGCCCAGGATGGGAGCTGTGG - Intronic
1168283908 19:55321048-55321070 CAGGTGAAGGATCGGGGCTGAGG + Exonic
1168327334 19:55545025-55545047 CAGCCCCAGGATGGAGGGTGGGG + Intronic
1168405940 19:56110758-56110780 CAGGCTATGGATGGGGGAGGCGG + Intronic
1168426273 19:56241726-56241748 CAGGGCTGGGATGGGGGTTGGGG - Intronic
925968088 2:9084732-9084754 CAGGGCCATGATGGAGGATGCGG + Intergenic
926213284 2:10887375-10887397 CTGGCCAAACATGGGGGCTGGGG - Intergenic
926542981 2:14204408-14204430 TAGGCACAGGATGGGGGCTGGGG - Intergenic
926562744 2:14435313-14435335 TAGGCACAGGATGGGGGGTGGGG + Intergenic
927022246 2:19029341-19029363 AAGGCCTAGGATGGAGGAGGGGG + Intergenic
927146101 2:20167710-20167732 CAGGCCCAGAAAAGGGGATGTGG + Intergenic
927256296 2:21043693-21043715 CAGGCTCAGGATGGGGGGCGCGG - Intronic
927843909 2:26461665-26461687 CAGGGCAGGGATGGGGGTTCAGG - Intronic
927930596 2:27041075-27041097 CAGCACAAGGATGGAGGCTGGGG - Exonic
928178223 2:29049579-29049601 CAGCCCCAGGGTGGGAGATGAGG - Intronic
928371018 2:30740328-30740350 CAGGCCAAGGCAGGTGGATCGGG - Intronic
929818726 2:45257016-45257038 CAGGCCTAGGCTGGGAAATGGGG + Intergenic
929906953 2:46054792-46054814 TAGGCACAGGATGGGGGGTGGGG - Intronic
930152346 2:48071274-48071296 CAGGCAAAGGAAGGATGATGCGG - Intergenic
930494398 2:52122717-52122739 TATTGCAAGGATGGGGGATGGGG - Intergenic
931650673 2:64465995-64466017 CAGTCCACGGCTGGGGGTTGGGG + Intergenic
931673742 2:64672770-64672792 CATGGCAAGGATGGGGGTAGGGG - Intronic
931938918 2:67230699-67230721 CAGGCACAGGATGGGGGATGGGG - Intergenic
932014595 2:68011575-68011597 CAGGCGAGGTATGGGGGAAGGGG + Intergenic
932119630 2:69086633-69086655 AAGGCCAGGGGTGGGCGATGGGG + Intronic
932239887 2:70148280-70148302 CTGGCCAAGGCTGGGAGGTGTGG + Intergenic
932761136 2:74440025-74440047 CAGGCCAGGGATGTGGGCGGGGG - Intronic
933606549 2:84389958-84389980 GAGGCCAAGGGTGGGGGTTGAGG - Intergenic
933729500 2:85446264-85446286 CAGGCCTTGCTTGGGGGATGGGG + Intergenic
934119350 2:88825144-88825166 CAGGCCATGGCTGGGAGGTGTGG + Intergenic
935051810 2:99530769-99530791 CAGGAAAAGGCTGAGGGATGAGG - Intergenic
936320645 2:111464225-111464247 TAAGCCAGTGATGGGGGATGGGG - Intergenic
936522409 2:113219550-113219572 CAGGCTAAATATGGGGAATGTGG + Intronic
936610418 2:113996960-113996982 CAGGGCTGGGATGTGGGATGTGG + Intergenic
937904536 2:127046417-127046439 CAGGGCCAGGATCGGGGCTGGGG - Intergenic
938150735 2:128880177-128880199 TAGGCACAGGATGGGGGGTGGGG + Intergenic
938259420 2:129884480-129884502 CAGTCTCAGGATGGTGGATGGGG + Intergenic
938426943 2:131200852-131200874 CAGCCCAAGGATCGTGGCTGGGG + Intronic
941720150 2:168803963-168803985 CAGGACAGGGATGGGGTAAGTGG + Intronic
942234758 2:173893206-173893228 CAGGCTAAGGTGGGAGGATGTGG - Intergenic
942426166 2:175863137-175863159 CAGACCCAGGATGGGAGAGGGGG - Intergenic
943257648 2:185616661-185616683 CAGGCCAAGGCAGGTGGATCAGG - Intergenic
944101143 2:196029374-196029396 CAGGGCAAGGGTGGGTGAGGAGG + Intronic
944775835 2:202963524-202963546 ACGGACCAGGATGGGGGATGGGG + Intronic
946058102 2:216918763-216918785 CAAGCCAAGGAAAGGGGGTGGGG - Intergenic
946191307 2:218009547-218009569 CAGGGAGAGGATGGGGGCTGGGG - Intergenic
946311608 2:218885133-218885155 CCAGCCAAGGAGAGGGGATGAGG + Intronic
946383838 2:219369351-219369373 CAGGCCAAGGTGGGGGGAATTGG + Intergenic
946685378 2:222264379-222264401 CAGGAGACGGATGGGGGATTGGG + Intronic
946689122 2:222297795-222297817 CAGAGCAAGAATGGGGGCTGGGG - Intronic
947227324 2:227852939-227852961 CAGGCACAGGATCGGGGGTGGGG + Intergenic
947544511 2:231001395-231001417 CAGGACAAGGATGGGGGTTGGGG - Intronic
947869233 2:233423755-233423777 CAGGCCAAGGATCCAGGAAGGGG - Intronic
948570131 2:238912649-238912671 GAGGCCAGGGCTGGGGGAGGAGG - Intergenic
948711273 2:239827249-239827271 CAGGCCAAGGACTGGGGCAGGGG - Intergenic
948815799 2:240509939-240509961 GAGGGCATGGATGGGGGAGGAGG - Intronic
948976295 2:241465766-241465788 CAGGCGAGGGATGGAGGAGGGGG - Intronic
1169091427 20:2863395-2863417 CAAGGCAAGGATGTGGGATGGGG + Exonic
1169142530 20:3234416-3234438 CAGCCCAGGGCTGGGGGCTGGGG - Intronic
1171348800 20:24487037-24487059 CGGGCCAAGGTTGGGGGGAGAGG + Intronic
1171880457 20:30614651-30614673 CTGGTCCAGGATGGGGCATGTGG - Intergenic
1171994959 20:31723761-31723783 CGGGCCGATGAAGGGGGATGTGG - Intronic
1172531138 20:35632102-35632124 GGGGCCAAGGATGGTGTATGGGG - Intronic
1172836622 20:37877427-37877449 CAGGCCCAGGCTGGGTGCTGAGG + Intergenic
1173340723 20:42150380-42150402 CAGGCCAGGGATCGCTGATGAGG + Intronic
1173523631 20:43716392-43716414 CCTGCTTAGGATGGGGGATGTGG + Exonic
1173818928 20:46008470-46008492 AAGGCCAAGGATGGGCCAGGGGG + Intergenic
1173852012 20:46224719-46224741 CAGGACTAGGTTGGGGGAGGAGG - Intronic
1174130450 20:48340456-48340478 CAGGCGCAGGACTGGGGATGTGG - Intergenic
1174269030 20:49353573-49353595 CAAGACAAGGATGGTGGAGGGGG - Intergenic
1174299089 20:49568771-49568793 CACGCCTGGGGTGGGGGATGGGG - Intergenic
1174571549 20:51505669-51505691 AAGGCCAAGCATCTGGGATGTGG - Intronic
1175357065 20:58376780-58376802 CAGAACCTGGATGGGGGATGGGG - Intergenic
1175371514 20:58495946-58495968 CAGGCCAAGGATGGGGGATGTGG - Intronic
1176042613 20:63073309-63073331 GAGGCCAGGGATGGGGAATGAGG + Intergenic
1176342197 21:5709460-5709482 CAGGTCTAGGCTGGGCGATGAGG - Intergenic
1176474451 21:7141612-7141634 CAGGTCTAGGCTGGGCGATGAGG - Intergenic
1176502630 21:7614996-7615018 CAGGTCTAGGCTGGGCGATGAGG + Intergenic
1176536518 21:8107529-8107551 CAGGTCTAGGCTGGGCGATGAGG - Intergenic
1176668562 21:9710550-9710572 CAGGCCAAGAAGGTAGGATGTGG + Intergenic
1176715461 21:10345842-10345864 CAGGGGAAGGATGGGGACTGTGG + Intergenic
1177801553 21:25833549-25833571 TAGGCACAGGATGGGGGGTGGGG - Intergenic
1179095883 21:38314114-38314136 TAGGCATAGGATGGGGGAAGGGG - Intergenic
1179177706 21:39021163-39021185 CACCCCAAGGATGGGCAATGTGG + Intergenic
1179373253 21:40826389-40826411 CAGGCCATGGAAGGGGTTTGAGG + Intronic
1179617930 21:42593741-42593763 CTGGCCGAGGAGGGAGGATGGGG + Intergenic
1180567909 22:16690902-16690924 CACGCCAGGGATGGGGAAGGTGG + Intergenic
1180602887 22:17034111-17034133 CAGGGGAAGGATGGGGACTGTGG - Intergenic
1180938049 22:19638737-19638759 CAGGGCAGGGCTGGGGGAGGGGG + Intergenic
1180994787 22:19959998-19960020 CAGGCAAAGGAAGGGGGCTTCGG + Intronic
1181316033 22:21971357-21971379 CGGGGCAAGCATGGGGCATGGGG + Intronic
1181441113 22:22935603-22935625 CAGGCCAAGGGATGGGGTTGGGG + Intergenic
1181545080 22:23598088-23598110 CAGGCCAAGGGATGGGGGTGGGG - Intergenic
1181684039 22:24516274-24516296 CAAGGCAGGGCTGGGGGATGAGG + Intronic
1181815231 22:25431794-25431816 CAGGCCAAGGGATGGGGGTGGGG + Intergenic
1182422665 22:30256153-30256175 CAGGCCAAGGCTGGAGAAGGGGG + Intergenic
1182457087 22:30458727-30458749 CAGGCCAGGCATGGTGGCTGAGG + Intronic
1182530831 22:30955243-30955265 CAGGCCAAGGCTGGGCGTGGTGG - Intronic
1182879332 22:33720013-33720035 CAGACAAAGGTTGGGGGAAGGGG + Intronic
1183419887 22:37705477-37705499 TAGGACAAGGATGGAGAATGGGG + Intronic
1183518449 22:38282008-38282030 GAGGCCAAGGCTGGTGGATCAGG - Intergenic
1183730465 22:39615623-39615645 CAGGACAAGGATGGGGAGAGAGG - Intronic
1184093496 22:42304437-42304459 CGGGGAAAGGCTGGGGGATGTGG - Intronic
1184258917 22:43303345-43303367 CAGGGCATGGATGGGGCAGGAGG - Intronic
1184288524 22:43485982-43486004 CAGGCAAAGGCTGGGGGAGATGG - Intronic
1184425836 22:44408886-44408908 CGGGACAGGGATGAGGGATGTGG - Intergenic
1184468040 22:44680401-44680423 ATGGGGAAGGATGGGGGATGGGG + Intronic
1185296336 22:50057100-50057122 CAGGTCTGGGTTGGGGGATGAGG + Intergenic
1203241463 22_KI270733v1_random:23940-23962 CAGGTCTAGGCTGGGCGATGAGG - Intergenic
949589039 3:5474127-5474149 CAGGGCAAAGATGGGGACTGAGG + Intergenic
950264667 3:11564887-11564909 CAGGCCAAGGCTGGGGAGGGAGG + Exonic
950899710 3:16486551-16486573 CAGGCAAAAGATGGGAGAAGAGG - Intronic
951887505 3:27538729-27538751 CAGGCCCAGGATGGAGAAGGGGG - Intergenic
952294101 3:32046140-32046162 GAGGCCAAGGAGGGAGGATCAGG + Intronic
952767667 3:36968977-36968999 CAGACAAAGGATGGGGGTTCAGG + Intergenic
953389327 3:42525497-42525519 AAGGCCACGGCTGGGGGAAGGGG - Intronic
953467212 3:43133082-43133104 CTGCCCACGCATGGGGGATGGGG - Intergenic
953781890 3:45878494-45878516 CAGGGTGAGGCTGGGGGATGGGG + Intronic
953853829 3:46485537-46485559 CAGGCTAAGGCTGGGGGCAGGGG + Intergenic
954312791 3:49783306-49783328 CAGGCCAAGGCTGAGGCAGGTGG + Intronic
954368533 3:50158398-50158420 GAGGCCAGGGCTGGGGGAGGTGG + Intronic
955217176 3:56993828-56993850 GAGGCCAAGGTAGGTGGATGAGG + Intronic
955236950 3:57148077-57148099 GAGGCCAAGGTTGGGGGGGGGGG + Intronic
955687295 3:61560929-61560951 CAGTCCAAGGCTGGGGAAAGTGG - Intergenic
957479302 3:80770777-80770799 CAGGCACAGGATAGGGGACGTGG + Intergenic
959135580 3:102415323-102415345 CTGGGCCAGGGTGGGGGATGAGG + Intronic
959190325 3:103103225-103103247 CATGCCAGTGATGGTGGATGTGG + Intergenic
959417122 3:106088930-106088952 AAGGCCAAGGATGGGGAAAGTGG - Intergenic
959728105 3:109568692-109568714 CTGGGCAAGGGTAGGGGATGAGG + Intergenic
960292157 3:115898746-115898768 AAGCTCAAAGATGGGGGATGGGG + Intronic
961446038 3:126982337-126982359 CAGGCCAAGGAAGGGGAAGCCGG - Intergenic
961624718 3:128254007-128254029 CAGGCCAGGGCAGTGGGATGAGG + Intronic
961654077 3:128432148-128432170 CAGGCCAGAGATGGGGGAGGTGG + Intergenic
961824072 3:129589686-129589708 CAGGCCTGGGCTTGGGGATGGGG - Intronic
962306868 3:134295339-134295361 CAGGTTAAGGATGAGGGATAAGG + Intergenic
962787671 3:138783518-138783540 GAGACCAAGGCCGGGGGATGGGG - Intronic
962990431 3:140572869-140572891 AAGGCCCAGGATGGGGGCTGGGG - Exonic
963018141 3:140845173-140845195 TAGACCAAGTAAGGGGGATGGGG + Intergenic
963240693 3:142999818-142999840 CAGGGCAAGGTTGAGGGAAGAGG + Intronic
963883607 3:150555208-150555230 CAGGCCAGGCATGGTGGCTGAGG - Intronic
964307570 3:155357290-155357312 CAGGCACAGGATGGAGGGTGGGG + Intergenic
965343574 3:167519628-167519650 CTGTCCAGGGGTGGGGGATGGGG + Intronic
965714824 3:171591607-171591629 CGGGCCCGGGCTGGGGGATGGGG - Intergenic
965778249 3:172256192-172256214 CAGGCCAAAAAAGGGGAATGAGG - Intronic
966639554 3:182174485-182174507 TAGGCCAAAGATGGGGAAAGTGG + Intergenic
966717646 3:183029900-183029922 CAGGCCAAGTATTTGGAATGGGG - Intronic
966810257 3:183837550-183837572 CAGGGCAGGGATGGGAGCTGAGG - Intronic
967089663 3:186124850-186124872 CAGGCCCAGCATGGGGCCTGGGG - Intronic
968519709 4:1029880-1029902 CAGGCCGAGGCTGGGGGCTGGGG + Intergenic
968727107 4:2252817-2252839 CAGGGTGGGGATGGGGGATGGGG - Intronic
968964043 4:3760506-3760528 CAGGCCCAGGATGGTGGAGCAGG + Intergenic
969495285 4:7522937-7522959 AAGGGGAAGGATGGGGGAAGAGG - Intronic
969636165 4:8370512-8370534 CAGGACAGGGATGGGGGAAGAGG + Intronic
969705880 4:8791286-8791308 CCAGCCGAGGTTGGGGGATGAGG - Intergenic
971025474 4:22585089-22585111 CAGGACATGGGTGGAGGATGAGG - Intergenic
971078655 4:23180703-23180725 GAGGCCAAGGCTGGTGGATCAGG + Intergenic
971303320 4:25459795-25459817 GAGGCCAAGGCGGGCGGATGAGG - Intergenic
972630422 4:40837160-40837182 CAGGCCGAGCATGTGGGCTGGGG + Intronic
973683588 4:53346559-53346581 GAGGCCAAGGCTGGGGGTGGTGG - Intronic
974420107 4:61662533-61662555 GAGGCCAAAGGTGGGGGCTGAGG + Intronic
975645019 4:76537484-76537506 TAGGGCAAGGATGTGGAATGAGG + Intronic
977584548 4:98760544-98760566 GAGGTCCAGGTTGGGGGATGGGG - Intergenic
977776357 4:100924563-100924585 CAGGACAGGGATTGGGGAAGAGG + Intergenic
978747755 4:112212935-112212957 CAGGCCATGGATGGGGGCTGGGG + Intergenic
978789533 4:112646205-112646227 GAGGCCAAGGCGGGTGGATGGGG - Intronic
981044327 4:140252209-140252231 CAGGAGGAGGATGGGGGCTGGGG + Intergenic
981225656 4:142290762-142290784 CTGGCCATAGATGGGGGACGTGG + Intronic
982104292 4:151998226-151998248 CTGGACCAGGGTGGGGGATGGGG - Intergenic
983009090 4:162522583-162522605 CAGCCCCAGGATGGGGACTGTGG + Intergenic
983277947 4:165641789-165641811 CATGCCAAGGGTGTGGGATGAGG - Intergenic
984905778 4:184624659-184624681 CAGGTCAATGATGGAGGCTGTGG - Intergenic
984905782 4:184624689-184624711 CAGGTCAATGATGGAGGCTGTGG - Intergenic
984944006 4:184957037-184957059 CAGGCCATGGAAGTGGGAGGTGG + Intergenic
985406222 4:189640977-189640999 CAGGCCAAGAATGTAGAATGTGG - Intergenic
985731810 5:1553679-1553701 CAGCCCATTGATGGGGGAAGTGG + Intergenic
985752959 5:1692897-1692919 TAGGCACAGGATGGGGGACGGGG + Intergenic
985944024 5:3162833-3162855 GAGGCCCGGGATGGGGAATGTGG - Intergenic
987121548 5:14772753-14772775 CAGGTAAAGGATAGGGGATCTGG - Intronic
988082611 5:26432985-26433007 AAGGCCACTGCTGGGGGATGTGG - Intergenic
990207811 5:53449090-53449112 CAGGCCAAGCATGGTGGCTCAGG + Intergenic
990528304 5:56650244-56650266 AAGGCCAGGGGTGGGGGATGCGG + Intergenic
990606611 5:57416957-57416979 CATGCAAAGCTTGGGGGATGCGG - Intergenic
994044906 5:95296539-95296561 AAGGTTAGGGATGGGGGATGAGG - Intergenic
994744772 5:103664792-103664814 CAGGACAGGGTTGGGGAATGTGG - Intergenic
995420601 5:111962702-111962724 TAGGCACAGAATGGGGGATGGGG - Intronic
996152644 5:120058460-120058482 CACGCCTGGGCTGGGGGATGGGG + Intergenic
997295671 5:132766842-132766864 CAGGCCAAGGCAGTGGGCTGTGG - Intronic
997610547 5:135212864-135212886 CAGGCTGAGGCTGGGGGATGGGG - Intronic
998369316 5:141650881-141650903 CAGGCCTAGGGTGAGGGCTGTGG + Intronic
998443609 5:142181735-142181757 CAGGCCAAGAATGGGAGCAGCGG + Intergenic
999078441 5:148819894-148819916 GAGGGCATGGATGGGGGATTAGG - Intergenic
999436939 5:151570575-151570597 AGGGCCAAGGATGGGGCAAGGGG + Intergenic
999690647 5:154143272-154143294 CAGGAGAAGGCTGTGGGATGTGG - Intronic
999795139 5:154981998-154982020 GAGGCCAAGGCGGGTGGATGCGG + Intergenic
1001197169 5:169684236-169684258 GAGGCTATGGGTGGGGGATGAGG - Exonic
1001289115 5:170443893-170443915 CAGGGCAGGGGTGGGGGCTGGGG + Intronic
1001414485 5:171535310-171535332 CAGGAGAAGGATGGGGAATGTGG + Intergenic
1001987261 5:176085459-176085481 GAGGCCAAGGAAGGTGGATCAGG - Intronic
1002104906 5:176875229-176875251 CAGGCTAAGGATGGGGGAGTGGG - Intronic
1002229606 5:177752690-177752712 GAGGCCAAGGAAGGTGGATCAGG + Intronic
1002265739 5:178031085-178031107 GAGGCCAAGGAAGGTGGATCAGG - Intronic
1002451408 5:179320949-179320971 AAAGCCAAGGGTTGGGGATGTGG + Intronic
1002462089 5:179379052-179379074 CAGGACAAGGACGGGGGCGGGGG - Intergenic
1002932971 6:1646997-1647019 CAGGGCAAGGAAGGGGCAAGAGG - Intronic
1003383883 6:5649819-5649841 CAGGCCAAGTTTGGCAGATGTGG + Intronic
1004401705 6:15294654-15294676 CAGGACATGGAAGGGAGATGAGG + Intronic
1004705259 6:18118521-18118543 CAGTCCAAGGATCGGGAATTGGG + Intergenic
1005809463 6:29505130-29505152 CAGGCCAATGTTGGGGGAAGTGG - Intergenic
1006313185 6:33275886-33275908 GAGGACAAGGAAGGGGGCTGGGG + Intronic
1006473988 6:34243725-34243747 CAGGGCAGGGCAGGGGGATGTGG - Intronic
1006534593 6:34688110-34688132 GAGGCCAGGGGTGGGGGTTGGGG + Intronic
1007009804 6:38405199-38405221 CAGGCCAGGTATGAGGGATCAGG - Intronic
1007474018 6:42107244-42107266 AAGGCCAAGGGTGGGGCAGGGGG + Exonic
1007495512 6:42257771-42257793 CTGGCCAAGAATTGGGGAGGAGG + Intronic
1007548810 6:42713394-42713416 CAGGCCAGGGGAGGGAGATGTGG + Intronic
1007622062 6:43221350-43221372 GAGGGCAAGGAGGGGGGAGGAGG + Intronic
1007675918 6:43594929-43594951 GAGGCCAAGGCTGGGGGCTGGGG + Intronic
1007733509 6:43966110-43966132 AAGGCCCTGGATGGGGGGTGTGG + Intergenic
1010556189 6:77282155-77282177 CAGGCACAGGATGGGGGAGCAGG + Intergenic
1011751871 6:90461942-90461964 GAGGCCACGGCTGGGGGACGGGG - Intergenic
1011859933 6:91741921-91741943 CAGGCCTAGGATGGTGGCTCAGG + Intergenic
1013109882 6:107056436-107056458 CAGGCCAAGGCGGGTGGATCAGG + Intergenic
1014221665 6:118804555-118804577 CAGGCCAAGACTGGGGTAAGAGG - Intergenic
1016020850 6:139235204-139235226 TAGACACAGGATGGGGGATGTGG - Intergenic
1016803813 6:148192543-148192565 CTGGCAAAGGAAGGGAGATGTGG + Intergenic
1017717978 6:157225271-157225293 CAGTGCAAGGATTGGGGATGTGG - Intergenic
1018391891 6:163347077-163347099 CAGGCCAGGGCTGGGCAATGCGG + Intergenic
1018598700 6:165514654-165514676 AATGCCATTGATGGGGGATGAGG + Intronic
1018699471 6:166415467-166415489 CAGGGGAAAGACGGGGGATGTGG + Intronic
1019166719 6:170102146-170102168 CAGGCCAAAGGCGGGGGGTGGGG - Intergenic
1019392152 7:794689-794711 CAGGACAGAGATGTGGGATGCGG + Intergenic
1019482597 7:1273584-1273606 CAGGGCAAGGGTGTGGAATGGGG + Intergenic
1019518156 7:1448562-1448584 CAGGCCAAGGATGGGGGGCCTGG + Intronic
1019627964 7:2030820-2030842 CAGGCGCAGGTTGGGGGCTGAGG - Intronic
1019918970 7:4150814-4150836 CAAGCCAGGGATGGGGGTTTTGG - Intronic
1020179852 7:5913796-5913818 CTGTGCAAGGATGGGGGAAGGGG - Intronic
1020303084 7:6811088-6811110 CTGTGCAAGGATGGGGGAAGGGG + Intronic
1020356250 7:7278888-7278910 TAGGCTCAGGATGGGGGTTGGGG - Intergenic
1020878629 7:13730077-13730099 GAGGCGAAGGATGGGGGCGGTGG + Intergenic
1022318176 7:29264020-29264042 CAGGCCCCGGGTGGGGGGTGGGG + Intronic
1023206618 7:37757662-37757684 CAGGTCAAGGCTGGGTGAGGTGG - Intronic
1023823099 7:43990942-43990964 CTGGGGAAGGATGGAGGATGAGG + Intergenic
1024919661 7:54544461-54544483 GAGGCAAAGGAAGGGGGCTGGGG + Intronic
1025245884 7:57316935-57316957 CAGGCCAAAAAAGGGTGATGGGG - Intergenic
1026491596 7:70868532-70868554 CAGGAGAAGGATGGGTTATGTGG + Intergenic
1026946184 7:74317676-74317698 CACACCAAGGATGGGGGGTGAGG + Intronic
1026978716 7:74514345-74514367 CAGGGCCAGGATGGGGGACTGGG + Intronic
1027623547 7:80521565-80521587 GAGGCCAAGCGTGGGGGGTGGGG - Intronic
1027670346 7:81088675-81088697 GAGGCCAAGGCGGGGGGATCAGG - Intergenic
1027679830 7:81205971-81205993 GAGGCCGAGGATGGTGGATCAGG - Intergenic
1027685464 7:81274523-81274545 CAGGCCACTGCTGGGGGATGGGG + Intergenic
1027713504 7:81639640-81639662 CAGTCCAAGTATGAGGGAAGAGG + Intergenic
1027984027 7:85262142-85262164 CAGGCCAAGAATGGGAGTAGTGG - Intergenic
1028401039 7:90425710-90425732 CAGGCTAGGGATGGGGGAGAGGG + Intronic
1028699411 7:93760157-93760179 CAGACAAAGGATGGGGGTTAGGG - Intronic
1028959762 7:96735565-96735587 CAGGTAGATGATGGGGGATGGGG - Intergenic
1029471714 7:100758739-100758761 CAGGGCACAGATGGGGGAAGAGG + Intronic
1029474249 7:100773602-100773624 CTGGCCAAGGCTGGGGGGCGAGG + Intronic
1029478395 7:100798806-100798828 CAGACTAAGGTTGGGGAATGTGG + Intergenic
1029751363 7:102544380-102544402 CTGGGGAAGGATGGAGGATGAGG + Intronic
1029769315 7:102643474-102643496 CTGGGGAAGGATGGAGGATGAGG + Intronic
1031934718 7:127724973-127724995 CAGGCCAAGGAAAGGGGCAGGGG - Intronic
1032316359 7:130842249-130842271 TAGGCCCAGGATGGGGGGTGTGG + Intergenic
1032610449 7:133407171-133407193 CAGATCAAAGGTGGGGGATGTGG - Intronic
1032792102 7:135249969-135249991 CAGGCCAGGGCTGGGCGATAAGG + Intronic
1033067034 7:138165992-138166014 GAGGCCAAGGGCGGGGGAGGGGG + Intergenic
1033890430 7:146006398-146006420 CAGGGGGAGGATGGGGGAGGAGG - Intergenic
1035034438 7:155885864-155885886 AAGGAAAAGGATGGGGGAGGAGG - Intergenic
1035383951 7:158458155-158458177 CAGGCCAAGCTCGGAGGATGGGG - Intronic
1035531566 8:356218-356240 TTGGCCAGGGATGGGGGCTGGGG + Intergenic
1035562430 8:616296-616318 CAGGACAAGCATGGGGCAAGAGG + Intronic
1035764930 8:2098395-2098417 GAGTCCAAGTATGGGGGACGTGG + Intronic
1036307293 8:7611528-7611550 CAGTCCCAGGATGGGGGAGGAGG + Intergenic
1036892814 8:12607431-12607453 CAGTCCCAGGATGGGGGAGGAGG - Intergenic
1037726561 8:21487362-21487384 GAGGCTAGGGATGGGGGTTGTGG - Intergenic
1038132254 8:24745492-24745514 CAGGCCATCTATGAGGGATGGGG + Intergenic
1038195154 8:25360413-25360435 GAGGCCCAGTATGGGGGGTGGGG + Intronic
1038404897 8:27314283-27314305 CAGGCCAGGCATGGCGGATCGGG + Intronic
1039354543 8:36800589-36800611 GAGGCCATGGATTGGAGATGGGG - Intronic
1040848619 8:51874133-51874155 CAGGCCAAGGTGGGCGGATCAGG - Intronic
1041023079 8:53657777-53657799 CAGAGCAAGGATGGGGGGTGGGG - Intergenic
1041327431 8:56683235-56683257 CAAGCCCAGGATGGGGGACTTGG - Intergenic
1041486685 8:58385155-58385177 GTTGCCAAGGATTGGGGATGGGG - Intergenic
1041871327 8:62637792-62637814 GAGGCCAACGAGGGGAGATGAGG + Intronic
1042715305 8:71765823-71765845 CAGGCCATTCATGAGGGATGGGG + Intergenic
1044158956 8:88888334-88888356 CAGGCCGGGGGTGGGGGATAGGG - Intergenic
1044448215 8:92302666-92302688 CGGGCACAGGATGGGGGACGTGG + Intergenic
1044728558 8:95212544-95212566 CAGGTGAGGGGTGGGGGATGAGG + Intergenic
1044893699 8:96864802-96864824 GAGGAATAGGATGGGGGATGGGG + Intronic
1045439741 8:102197682-102197704 AAGGCCAGAGATGGGGAATGGGG + Intergenic
1045630004 8:104107817-104107839 CATGCCAAGGCTGAGGGAGGAGG + Intronic
1046198040 8:110888871-110888893 CATGCCTAGGGTGGGGTATGGGG - Intergenic
1047177801 8:122557988-122558010 AAGGCAAAGGATGGGAGATCAGG - Intergenic
1048439568 8:134450111-134450133 TAGGCAAACGATGGGGGGTGGGG - Intergenic
1048641725 8:136370398-136370420 TAGGCACAGGATGGGGGATGGGG + Intergenic
1048869993 8:138789417-138789439 CAGGCTAAGAATAGGAGATGGGG + Intronic
1048918849 8:139209639-139209661 CAGGCTAAGAATAGGAGATGGGG + Intergenic
1049386229 8:142344408-142344430 CGGGCCAATGGTGGGTGATGAGG + Exonic
1049667978 8:143856564-143856586 GAAGGCTAGGATGGGGGATGCGG - Intergenic
1050472482 9:6007795-6007817 CAGGCCTAGGCTGGGCGGTGTGG + Intronic
1050784866 9:9388233-9388255 TAGGCCCAGGATGGGGGTTGTGG + Intronic
1051887186 9:21905346-21905368 CAGGCACAGGATGGGGGGCGTGG + Intronic
1052169713 9:25377844-25377866 TAGGCACAGGATGGGGGATGGGG + Intergenic
1052337518 9:27335606-27335628 TCGGCCACCGATGGGGGATGAGG - Intronic
1053266103 9:36714579-36714601 CAGGCTCAGGGTGGGGGAAGTGG + Intergenic
1054793882 9:69280616-69280638 CAGGAGAAGGAAGGGGGAAGGGG + Intergenic
1054944696 9:70783532-70783554 CAGACCAAGGAAAGGGCATGAGG + Intronic
1055120245 9:72651901-72651923 AAGGGAAAGGATGGGGGGTGAGG - Intronic
1055241132 9:74187842-74187864 CAAGACAAAGAAGGGGGATGGGG + Intergenic
1055632483 9:78237864-78237886 GAGGCCAAGGCGGGGGGGTGTGG + Intronic
1055883651 9:81032931-81032953 GAGGGCAGGGATGGGGGCTGAGG + Intergenic
1055928119 9:81531648-81531670 CAGGCCCATTCTGGGGGATGGGG - Intergenic
1056059534 9:82870034-82870056 CAGTCACAGGATGGGGGATGAGG - Intergenic
1056869677 9:90265616-90265638 CAAGCCAAGAATGGAGAATGTGG - Intergenic
1056885042 9:90433733-90433755 CAGGCCCGGGGTGGGGGAGGGGG - Intergenic
1057201607 9:93143468-93143490 CAGTCCAAGGAAGGTGGACGTGG + Intergenic
1057312012 9:93948771-93948793 CCGGCCCGGGATGGGGGAGGGGG - Intergenic
1057348747 9:94276624-94276646 GAGGCCAAGGATGGATGACGAGG - Intronic
1057818281 9:98311732-98311754 CTGGCCAAGGATGAGTCATGTGG - Intronic
1057959175 9:99438372-99438394 CAGGCCAGAGATGGTGGGTGAGG - Intergenic
1059171073 9:112125749-112125771 AAGGCCAAGGATGGCTGATGGGG - Intronic
1059927984 9:119230885-119230907 TAGGCCAGGGAAGGGAGATGGGG - Intronic
1061136887 9:128739901-128739923 CAGGGCAGGGAGCGGGGATGCGG - Intronic
1061220338 9:129246878-129246900 CAGCCGAAGGATGGGGGAGATGG + Intergenic
1061719782 9:132544444-132544466 CAGGGCCAGGATGGAGGCTGTGG - Intronic
1062098926 9:134717898-134717920 CAACCCAGGGATGGGGGATGGGG + Intronic
1062323359 9:136001261-136001283 CCGGCCAGGGCTGGGGGCTGGGG - Intergenic
1062424166 9:136498338-136498360 CAGGGCCAGGATGAGGGCTGGGG + Intronic
1062690160 9:137837520-137837542 CAGGCCTGGGAAGGGGGCTGAGG + Intronic
1062733364 9:138121256-138121278 CAGGCCCAGGAATGGGGTTGGGG - Intronic
1203457784 Un_GL000220v1:7014-7036 CAGGTCTAGGCTGGGCGATGAGG - Intergenic
1203657304 Un_KI270753v1:10391-10413 CAGGCCAAGAAGGTAGGATGTGG - Intergenic
1185778906 X:2829122-2829144 GAGGCCGAGGCTGGGGGCTGGGG + Intronic
1186223698 X:7375524-7375546 GAGGCCAAGGAGTGGGGCTGAGG - Intergenic
1186444557 X:9615726-9615748 CTGGCCAAGGATGGGAAAGGGGG - Intronic
1188090897 X:25964319-25964341 CAGGGGAAGGATGGGGGACAAGG + Intergenic
1188182659 X:27075136-27075158 TAGGCACAGGATGGGGGATGGGG - Intergenic
1189332379 X:40151964-40151986 CAGGCCCAGGAGAGGGGAAGAGG + Intronic
1190249077 X:48708582-48708604 CAGGCCAAGAATTGGGGGTGGGG + Exonic
1191951895 X:66601830-66601852 GAGGACAAAGATGGGGGAGGTGG - Intronic
1192284256 X:69717754-69717776 GAGGCCAAGGAGGGTGGATCAGG - Intronic
1192432200 X:71119901-71119923 CAGGCCAAGGAGGGAGCATGGGG + Intronic
1193773950 X:85620544-85620566 CTGGCCCAAGCTGGGGGATGGGG - Intergenic
1195854114 X:109311619-109311641 TAGGAACAGGATGGGGGATGGGG + Intergenic
1196316331 X:114229192-114229214 CTGGCCAAGGAGGAGGGAGGAGG - Intergenic
1196378973 X:115068869-115068891 GAGGCGCAGGATGGGGGATGAGG + Intergenic
1196717827 X:118827228-118827250 CAGGAGACTGATGGGGGATGGGG + Intergenic
1196717936 X:118827818-118827840 CAGGACAAGGCTGGGGAATGGGG + Intergenic
1197167645 X:123395426-123395448 CAGGCAAAGGGTGGGGGCAGTGG + Intronic
1197205230 X:123784058-123784080 GAGGCCAAGGCAGGGGGATCAGG + Intergenic
1197324899 X:125080896-125080918 CAGGGTAAGTATCGGGGATGGGG - Intergenic
1197809744 X:130430612-130430634 CAGCTCAGAGATGGGGGATGGGG - Intergenic
1199298446 X:146185845-146185867 CTGGCCAGGCATGGGGGCTGAGG - Intergenic
1199664089 X:150082843-150082865 TAGGCCAGGGCTGGGGGATGTGG + Intergenic
1199894605 X:152118086-152118108 CAGGATAGGGGTGGGGGATGTGG + Intergenic
1199967861 X:152834706-152834728 GAGGCCAAGCATGAGGCATGAGG + Intronic
1200116472 X:153771835-153771857 CAGGCAAATGATGGCAGATGGGG - Intronic
1200790636 Y:7296187-7296209 GAGGCCAAGGAGGGTGGATCAGG + Intergenic
1201283396 Y:12359930-12359952 CAGGGCAAGGGATGGGGATGAGG + Intergenic
1201630815 Y:16070559-16070581 AAAGCCAAGGATGGGTGTTGGGG + Intergenic