ID: 1175371690

View in Genome Browser
Species Human (GRCh38)
Location 20:58496754-58496776
Sequence TGTTACAGGCAGAAGCTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 6, 3: 37, 4: 271}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175371687_1175371690 -7 Left 1175371687 20:58496738-58496760 CCAGAAGTCCTTGGGGTGTTACA 0: 1
1: 0
2: 0
3: 4
4: 135
Right 1175371690 20:58496754-58496776 TGTTACAGGCAGAAGCTGCAAGG 0: 1
1: 0
2: 6
3: 37
4: 271
1175371685_1175371690 0 Left 1175371685 20:58496731-58496753 CCTGACACCAGAAGTCCTTGGGG 0: 1
1: 0
2: 1
3: 11
4: 143
Right 1175371690 20:58496754-58496776 TGTTACAGGCAGAAGCTGCAAGG 0: 1
1: 0
2: 6
3: 37
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175371690 Original CRISPR TGTTACAGGCAGAAGCTGCA AGG Intronic
900484447 1:2914788-2914810 TGTTGTTGGCAGAAGCTACATGG + Intergenic
903454098 1:23474924-23474946 TGGTTCAGGCAGCACCTGCATGG + Intronic
907221523 1:52910718-52910740 TTTTACAGGCAGAGTCAGCAAGG + Intronic
909244167 1:73255934-73255956 TTTTACATGCAGAAGCTGAAAGG + Intergenic
909852869 1:80490946-80490968 ACTGACAGGCAGAAGCTACATGG + Intergenic
910122255 1:83803130-83803152 TGCTACATGCTGAAGATGCATGG + Intergenic
910810017 1:91226534-91226556 TCTTGCAGCCAGAGGCTGCATGG - Intergenic
911450803 1:98058047-98058069 AGTTTAAGGCAGAAGCTTCAAGG + Intergenic
913185354 1:116365678-116365700 TGCTGCAGGCTGGAGCTGCAGGG - Intergenic
914672871 1:149885285-149885307 TGTGCCAGGCTGAAGATGCACGG + Exonic
915641997 1:157234914-157234936 TCTTGCAGCCAGAGGCTGCATGG - Intergenic
916227949 1:162508562-162508584 GATTACAGGCAGATGCTGCTAGG - Intronic
918232463 1:182548657-182548679 TGTCACTGGCAGAGGCTCCACGG - Intronic
920431273 1:205920839-205920861 GGCTTCAGACAGAAGCTGCAGGG + Intronic
920975049 1:210777931-210777953 TGATCCAGGCAGAGCCTGCAAGG - Intronic
921022616 1:211249988-211250010 TCTTGGAGCCAGAAGCTGCATGG + Intergenic
921258429 1:213363517-213363539 TGTTCCAGGCAGAAGGGGCCTGG + Intergenic
921945704 1:220884616-220884638 TGTTGCAGGGAGAAGCTCCGAGG - Exonic
922006499 1:221535850-221535872 TGTTACAGGAAGATGCGGGAGGG + Intergenic
1063087950 10:2836495-2836517 TCTTAGAGGCAGAACCTGCTGGG + Intergenic
1063287859 10:4709680-4709702 TGACACAGGCACCAGCTGCATGG + Intergenic
1063728746 10:8670973-8670995 TGCTACAGGCATAGGTTGCATGG + Intergenic
1066083380 10:31954387-31954409 GGTAACAGGCAGAAGTTGGAGGG + Intergenic
1066237765 10:33502893-33502915 AGAGACAGGCAGAAGCCGCAGGG + Intergenic
1067110020 10:43393760-43393782 TGTTGCAGGCAAAAGTTGCAAGG - Intronic
1067570157 10:47365691-47365713 TGAGAGAGGCAGAGGCTGCAGGG + Exonic
1067811206 10:49428734-49428756 TGTTCCTGGCAGCAGCTGCCTGG + Intergenic
1067922398 10:50473193-50473215 TGTTCCAGACAGAGGCTGCTTGG - Intronic
1068175686 10:53454946-53454968 TGTTACCAGCAGAATCTGAAGGG + Intergenic
1069829659 10:71275003-71275025 TTTTACAGACAGAAACTCCAGGG + Intronic
1070462851 10:76687257-76687279 TGTTCCAGGCAGTATATGCAAGG - Intergenic
1074262525 10:111868826-111868848 TCTTGCAGCCAGAGGCTGCATGG + Intergenic
1075376647 10:121983378-121983400 GATTACAGGCATAAGCTGCCAGG + Intergenic
1076260344 10:129060027-129060049 GGATACAGGCTGAAGCTGGATGG + Intergenic
1076867885 10:133177094-133177116 TCTGCCAGGCAGCAGCTGCATGG - Intronic
1076922601 10:133462570-133462592 TGCCACAGGCAGCAGCAGCAAGG + Intergenic
1078060395 11:8039354-8039376 GGAGACAGGCAGAAGCTGGAAGG - Intronic
1078396949 11:10989548-10989570 ACTCAGAGGCAGAAGCTGCAGGG - Intergenic
1078397401 11:10993251-10993273 GGTCCAAGGCAGAAGCTGCAAGG + Intergenic
1081251604 11:40842256-40842278 TGCAGGAGGCAGAAGCTGCATGG - Intronic
1082960433 11:58914181-58914203 TGTTAAAAGCAGAAACAGCATGG - Intronic
1082980373 11:59115338-59115360 TGTTAAAAGCAGAAACAGCATGG - Intronic
1084542908 11:69798413-69798435 TCTGCCAGGGAGAAGCTGCATGG + Intergenic
1085397932 11:76216720-76216742 GGGTGAAGGCAGAAGCTGCAAGG - Intergenic
1086133512 11:83423877-83423899 TCCTACAGCCAGAGGCTGCATGG - Intergenic
1086766268 11:90699222-90699244 TATTACATGTAGAAGCTGCAGGG - Intergenic
1088334270 11:108686168-108686190 TGATAATGGCAGAGGCTGCATGG - Intronic
1088595388 11:111436958-111436980 TGTGGCAAGCAGACGCTGCAGGG + Intronic
1088688375 11:112304252-112304274 TGTTACAGGCATATGGGGCAGGG + Intergenic
1090183685 11:124722202-124722224 TGTACCAGGGAGAAGGTGCAAGG - Intergenic
1090939201 11:131372666-131372688 TGTTACAGGCAGAAGAGACATGG - Intronic
1091514386 12:1164119-1164141 TGTTAGAAGCAGAAGCTGCTTGG + Intronic
1094758525 12:33500130-33500152 GATTACAGGCAGATGCTGCCAGG + Intergenic
1094770458 12:33652352-33652374 TCTTGAAGCCAGAAGCTGCATGG + Intergenic
1094791961 12:33925989-33926011 TGTATCAGGCAGGAACTGCATGG - Intergenic
1095989305 12:48023378-48023400 TGTTACAGGCAGTTCCTTCAGGG - Intronic
1096090238 12:48894632-48894654 TATTACAGGCATGAGCTGCTGGG - Intergenic
1097106200 12:56627212-56627234 GGTTACAGGCATAAGCCACAGGG - Intronic
1097491686 12:60279450-60279472 AGTTTCAGGCAGAGGCAGCATGG + Intergenic
1099975348 12:89540797-89540819 TTTCACAGGCATGAGCTGCATGG - Intergenic
1100052257 12:90462573-90462595 TGTTATGGGCAGAATCTGGAGGG - Intergenic
1102225556 12:111225768-111225790 TCTTTCAGGCAGAATCTGCCAGG + Intronic
1102410795 12:112716591-112716613 TGTTAAAGGCACAAGTTGGAAGG + Intronic
1102461433 12:113102086-113102108 TTTTACAGGAAGAAGGAGCACGG - Intronic
1103388639 12:120553978-120554000 CCTGAGAGGCAGAAGCTGCAGGG - Intronic
1103436283 12:120929369-120929391 AGGTACAGACAGAAGTTGCAGGG - Intergenic
1103683189 12:122710714-122710736 TCTTGCAGCCAGAGGCTGCATGG + Intergenic
1103963374 12:124623018-124623040 AGGTGCAGGCAGGAGCTGCAGGG + Intergenic
1104716501 12:131019760-131019782 TGTTCCAGGGAGATGCTCCAGGG + Intronic
1106590552 13:31094936-31094958 TTTTGTAGCCAGAAGCTGCATGG + Intergenic
1107953930 13:45491054-45491076 TGTTACAAGAACAAGCTGGAAGG - Intronic
1108104562 13:46994778-46994800 TGTCACTAGCAGAATCTGCATGG - Intergenic
1108359365 13:49655044-49655066 GGTTACAGGCAGCAGCTGGCGGG - Intergenic
1108422753 13:50267385-50267407 TTTTACAGGCCGAAGCTGAACGG + Intronic
1108784419 13:53878002-53878024 AGACATAGGCAGAAGCTGCAAGG + Intergenic
1109073225 13:57796537-57796559 GGAAACAGGCAGAAGCTACAAGG - Intergenic
1109498537 13:63208447-63208469 TGTCACAGCAAGAAGGTGCAAGG - Intergenic
1110281579 13:73699768-73699790 TTTTAAAGGCAGAAGCAGCAGGG + Intronic
1110573419 13:77030070-77030092 TGCAACAGGCAGAAGCTGGAAGG + Intergenic
1110680538 13:78306798-78306820 TGGAATAGGCTGAAGCTGCAAGG + Intergenic
1112409734 13:99152735-99152757 ATTCCCAGGCAGAAGCTGCAAGG - Intergenic
1112650908 13:101397266-101397288 TGATACATGCAGGATCTGCATGG - Intronic
1113817034 13:113179549-113179571 TGTGACAGGCAGAAGTGGCTGGG + Intronic
1115836325 14:37408777-37408799 TGTGGCAGGCAGATACTGCAGGG + Intronic
1116927070 14:50650573-50650595 TGACCAAGGCAGAAGCTGCACGG - Intronic
1118806806 14:69245046-69245068 TGGGACAGGCAGAAGGTGCTGGG - Intergenic
1118890170 14:69902531-69902553 GGGTGAAGGCAGAAGCTGCAAGG - Intronic
1119184628 14:72631184-72631206 GAATACAGGCAGAAGCAGCAAGG + Intronic
1121947202 14:98135036-98135058 TGAAACAGGCAGAAGCTGCCAGG + Intergenic
1121958283 14:98235152-98235174 TGTTACAGGAAGAACCTGTTTGG + Intergenic
1123474748 15:20581843-20581865 TTTTGCAGGCAGCAGCTGCCAGG - Intergenic
1123643263 15:22418514-22418536 TTTTGCAGGCAGCAGCTGCCAGG + Intergenic
1126130231 15:45333798-45333820 AGATCCAGGCAAAAGCTGCATGG + Intergenic
1127365124 15:58282394-58282416 GGTCAAAAGCAGAAGCTGCAAGG + Intronic
1128081042 15:64857033-64857055 GGTCACAGGCAGACGCTGCCAGG + Intronic
1129014616 15:72455537-72455559 TGTTTCAGGTGGTAGCTGCAGGG - Intergenic
1131406941 15:92172823-92172845 TGTTACCAGTAGAAGCTGCATGG - Intergenic
1133231614 16:4369664-4369686 TGCTACAAGGAGCAGCTGCAAGG + Intronic
1133329142 16:4960571-4960593 TGTTACAGGCAGATGGTTCTAGG + Intronic
1134225760 16:12388804-12388826 TGTTACAGGCAGAACCCTCCAGG - Intronic
1134469004 16:14505403-14505425 AGTTAAAGGCTGAAGCTGGAGGG + Intronic
1137225383 16:46500818-46500840 TGTTGCAGGAAGAAATTGCAAGG - Intergenic
1138985952 16:62328707-62328729 TGTTATAGGCAGAACATGAAAGG - Intergenic
1139675737 16:68522223-68522245 TCTTACAGACAGAACCTGCTTGG + Intergenic
1140891920 16:79292097-79292119 TTTTCCAAGCAGAAGCTGTAGGG + Intergenic
1141151663 16:81568506-81568528 TGTGCCAGGCAGGAGCTCCAGGG + Intronic
1141162487 16:81638631-81638653 AGGTGCAGGCAGAAGCTGCCGGG - Intronic
1142005447 16:87687622-87687644 AGGCACAGGAAGAAGCTGCAGGG + Intronic
1142354608 16:89596662-89596684 TGTTGCAGACAGAGGCTGTACGG - Exonic
1146896580 17:36545611-36545633 TGTTGCAGGCAGGAGCTGGGAGG + Exonic
1148201457 17:45752691-45752713 AGTTCCAGGCAGAAGCTGCAAGG - Intergenic
1148214153 17:45825335-45825357 TGATACAGGCAGCAGGTGTAGGG - Intronic
1148670808 17:49408714-49408736 TGACACAGGCAGAAACTGCCTGG - Intronic
1148731622 17:49840172-49840194 TCTAACAGGCAGAAACTGCTGGG + Intronic
1148839070 17:50483243-50483265 TGTTAGAGGCAGTTGCTCCAGGG + Intronic
1149494731 17:57110017-57110039 TGTTCCTGTCAGAACCTGCAGGG - Exonic
1149561619 17:57611609-57611631 AGACTCAGGCAGAAGCTGCAAGG - Intronic
1149626877 17:58085662-58085684 GGTTCCAGGCAGACCCTGCATGG - Intronic
1150973191 17:70053818-70053840 TCTTGCAGTCAGAGGCTGCATGG + Intronic
1152370713 17:79886934-79886956 TGTTCCAGGCAGAGGCCCCAAGG + Intergenic
1153305698 18:3628578-3628600 TGTAACAGGGAAAAGATGCACGG - Intronic
1156604221 18:38646643-38646665 TGTTACAGACATAAGCTGGAAGG + Intergenic
1157538832 18:48484158-48484180 GGCAACAGGCAGAAGCTGGAAGG + Intergenic
1159101170 18:63961048-63961070 TGTTACAGCCAGGAGCAACAGGG + Exonic
1159262777 18:66037464-66037486 AATTTCAGGAAGAAGCTGCATGG + Intergenic
1162498759 19:11038946-11038968 GATTACAGGCACAAGCTGCCAGG - Intronic
1162732791 19:12729021-12729043 TGTTGGAGCCAGAAGCTGCCTGG - Intergenic
1162914386 19:13866097-13866119 CATTACCGGCAGCAGCTGCAGGG + Intronic
1163318378 19:16556935-16556957 GGTTCCCCGCAGAAGCTGCAGGG - Intronic
1163819018 19:19485582-19485604 GGGCTCAGGCAGAAGCTGCAAGG + Intronic
1163826451 19:19527328-19527350 TGTTACAGGCAGAAACCGACCGG + Exonic
1166271037 19:41714264-41714286 GGTGACAGGCAGGAGCTGCCCGG - Intronic
1166687485 19:44804279-44804301 AGACCCAGGCAGAAGCTGCATGG + Intergenic
1167727111 19:51223727-51223749 TTTCACAGGAAGATGCTGCATGG + Intergenic
926704300 2:15825966-15825988 TGTTACAGGCAGGAGCTGCGAGG + Intergenic
927246668 2:20962181-20962203 TGGACCAGGCAGAAGCTGCAAGG - Intergenic
927908367 2:26878825-26878847 TGTTCCAGACAGAAGCTGTGTGG - Intronic
928494810 2:31820675-31820697 GGTAACAGGCAGAAGTTGCAAGG - Intergenic
929457524 2:42076470-42076492 AGGTCCAGGCAGAACCTGCAGGG - Intergenic
929827311 2:45319296-45319318 TTTTACTGGCATCAGCTGCAAGG + Intergenic
930203600 2:48566887-48566909 CGTTACAGGCTGAAGTTGAAAGG + Intronic
932399951 2:71473465-71473487 AGTTACTCTCAGAAGCTGCAGGG - Intronic
932966362 2:76480122-76480144 TGACAAAGGCAGAAGCTTCACGG - Intergenic
933146853 2:78864244-78864266 TCCTACAGGTAGAAGTTGCATGG + Intergenic
935940109 2:108229157-108229179 GGTTCTAAGCAGAAGCTGCAAGG + Intergenic
936249174 2:110854287-110854309 AGGTACAGGCAGAAGATGCCTGG - Intronic
936681446 2:114777519-114777541 TGTTACAGTCATAAACAGCAAGG + Intronic
937118953 2:119428968-119428990 TGTTAAAAGCAGAAACAGCATGG - Intergenic
937204679 2:120227826-120227848 TGTTACAGGGAGGTGCTGCTGGG + Intergenic
939264499 2:139853683-139853705 TGTCCCAGGCAGAAGCTGCAAGG + Intergenic
940724774 2:157324455-157324477 TGTTCAAGGCTGAGGCTGCATGG - Intronic
946059731 2:216931550-216931572 TGACGCAGGAAGAAGCTGCATGG + Intergenic
946337553 2:219048728-219048750 AGAATCAGGCAGAAGCTGCATGG + Intergenic
947529804 2:230901588-230901610 TGTCAAAGGCAGAATCTGCTGGG + Intergenic
948649488 2:239431665-239431687 AGTCACAGACAGGAGCTGCAGGG - Intergenic
1170739778 20:19045468-19045490 TGTTACAGTCAGAAGTACCAAGG - Intergenic
1170830191 20:19833093-19833115 TGTTAGAGGCAGAAGGTGAGGGG - Intergenic
1173149160 20:40551050-40551072 TGCTTCAGGCAGCAGCTGCCTGG - Intergenic
1174993418 20:55538933-55538955 TTTAACAGGTAGATGCTGCAGGG - Intergenic
1175228143 20:57457008-57457030 TGTTCCATGCAGAGGCTCCATGG + Intergenic
1175371690 20:58496754-58496776 TGTTACAGGCAGAAGCTGCAAGG + Intronic
1179278961 21:39917467-39917489 TGGTAGAGGGAGAAGCTGGAAGG + Intronic
1179464186 21:41560872-41560894 TGTTAGAGGAAGGAGCTGCAGGG - Intergenic
1180086947 21:45511967-45511989 TGTGTCTGGCAGAAGCAGCATGG + Intronic
1180660028 22:17459170-17459192 AGTTACAGTAAGAACCTGCAGGG + Intronic
1181666089 22:24398543-24398565 GGTTACAGGAAGAAGCTTCAAGG - Intronic
1181721225 22:24776060-24776082 TCTTGCGGCCAGAAGCTGCATGG + Intergenic
1182896159 22:33861076-33861098 TGTTCGAGGCAGAGGCTGCCTGG - Intronic
1184358398 22:43997714-43997736 CATTACCTGCAGAAGCTGCAGGG + Intronic
949158325 3:852568-852590 TGTTACACCCAGAAGCTGGCTGG + Intergenic
949626939 3:5877735-5877757 TCTTACAGCCATAGGCTGCATGG - Intergenic
951345929 3:21547028-21547050 GGATACAGGCAGAAGATGAATGG - Intronic
952271211 3:31833458-31833480 CCTGACATGCAGAAGCTGCATGG + Intronic
954010214 3:47629981-47630003 TGTTCCAAGCAGAAGCTACAGGG + Intronic
955108010 3:55918629-55918651 TGTTTCAAGAAGAAGCTTCAAGG - Intronic
956171591 3:66437693-66437715 TGCTACATGCAGCTGCTGCAAGG + Intronic
956499174 3:69863473-69863495 TGTTACTGGCTGAACCTGCCAGG + Intronic
960170350 3:114453988-114454010 TGTTTCAGGGAGTAGCTGCCCGG - Intronic
962829141 3:139124281-139124303 TGCCCCAAGCAGAAGCTGCAGGG + Intronic
964241747 3:154602212-154602234 TGTAACAGGCAGAGGTTGAAAGG - Intergenic
966903386 3:184503802-184503824 TGATGCAGGCAGAAGGTGGAAGG + Intronic
967956077 3:194878410-194878432 GGTTGTAGGCAGAAGCTGGAAGG + Intergenic
970273852 4:14375935-14375957 TGTTACTGGCAAAAACTGCAAGG + Intergenic
970741888 4:19249437-19249459 AGGTACAGGCAGATGCTGCAGGG + Intergenic
970744764 4:19281469-19281491 TTTTACAGGCACAGGGTGCAAGG + Intergenic
970969522 4:21965441-21965463 TGTAATATTCAGAAGCTGCACGG + Intergenic
971012358 4:22452345-22452367 TGTTACAGGCATAGATTGCATGG - Intronic
971019235 4:22517004-22517026 TGTTTCAGGGAGAAACTCCAAGG - Intergenic
971642684 4:29156161-29156183 TGGCACAGGCAGAAGTTGAAAGG - Intergenic
974046668 4:56904452-56904474 TGTTAGAGACAGAAACAGCAGGG + Intergenic
975850476 4:78566764-78566786 TCTTACATGCAGATGGTGCATGG - Intronic
977514445 4:98003232-98003254 TTTTACAGGCAGAAGCTGGAAGG + Intronic
977901204 4:102424467-102424489 TGAACAAGGCAGAAGCTGCATGG - Intronic
979898856 4:126192571-126192593 TCTTGCAGCCAGAGGCTGCATGG - Intergenic
980529072 4:134027173-134027195 AGATCCAGGCAGAAGCTGCATGG - Intergenic
980789985 4:137608064-137608086 TTATAAAGGCAAAAGCTGCAGGG + Intergenic
981925717 4:150137311-150137333 TGGTAAAGGCAGAAGCAGGAGGG + Intronic
982237806 4:153268242-153268264 TCTTGCAGCCAGAGGCTGCATGG + Intronic
982866182 4:160514735-160514757 TGCTACAGGCAGAAGCAGCATGG - Intergenic
983660073 4:170122329-170122351 TCTTGCAGCCAGAGGCTGCAAGG - Intergenic
986745099 5:10736838-10736860 TCTTCCAGGGAGAAGCTGTAAGG - Intronic
987056065 5:14193114-14193136 TGTTACTACCAGAAACTGCATGG - Intronic
987261777 5:16211573-16211595 AGAAACAGGCAGCAGCTGCAAGG - Intergenic
987467478 5:18289662-18289684 TGGTCCAGGCAGAAGCAGCAAGG - Intergenic
988497020 5:31754171-31754193 GGCTGCAGGCAGAGGCTGCAAGG - Intronic
988878082 5:35470405-35470427 TGTTAGAGGCTGCAGCTTCACGG - Intergenic
988973649 5:36494007-36494029 TTTTACAGACAGAAGCAGAAAGG + Intergenic
989148333 5:38271189-38271211 TTTTTCAGGCATCAGCTGCATGG + Intronic
991227057 5:64285646-64285668 TGTTGCAGGCAGACGCAGCTAGG + Intronic
991499247 5:67259753-67259775 TGTTACAGGAAGCACCTGGAGGG + Intergenic
992231707 5:74670553-74670575 TGTAACAGGAAGTAGCAGCAGGG + Intronic
993790926 5:92210185-92210207 TCTTGCAGCCAGAGGCTGCATGG + Intergenic
994474095 5:100245354-100245376 AGGTACAGGCAGAAGCTACATGG - Intergenic
995271087 5:110220306-110220328 TTTTCCATGAAGAAGCTGCATGG + Intergenic
995824657 5:116282154-116282176 GGTTTCTGGCAGAAGCTGGAGGG - Intronic
996513799 5:124347465-124347487 AATCTCAGGCAGAAGCTGCAAGG - Intergenic
996696994 5:126408666-126408688 AGTCTCAGGCAGAAGCTGCAAGG - Intronic
997017309 5:129951586-129951608 TTTTACAGGCAGAATCACCAGGG - Intronic
999426503 5:151491933-151491955 TGTTACAGGCTGATGCTGTCGGG - Exonic
999438225 5:151581025-151581047 AGTTACAGGCAGAACCTGGTTGG - Intergenic
1000413961 5:160964098-160964120 TGGTCCAGGCAGAAGATGAAAGG - Intergenic
1001749894 5:174120844-174120866 TGTTCCCTGCAGCAGCTGCAGGG + Intronic
1001757448 5:174181353-174181375 AGTTACAGGCAGATGCTTCAAGG + Intronic
1002422339 5:179155141-179155163 TGTTACAGGCAGAACGGCCACGG - Intronic
1003142506 6:3483130-3483152 TGTGAGAGGCAGGAGCTGTAAGG - Intergenic
1004471387 6:15932547-15932569 TGAATCAGGTAGAAGCTGCATGG + Intergenic
1004560725 6:16747466-16747488 TGTTACAGGGAGGAGCTTCCCGG + Intronic
1005959126 6:30683920-30683942 TGTTCTAGGGAGAAACTGCAGGG - Intronic
1006931012 6:37688523-37688545 TGTGAAAGGCTGGAGCTGCAGGG - Intronic
1007130642 6:39470362-39470384 CGTCACAGGCAGGAGCTGCAAGG - Intronic
1007374593 6:41447771-41447793 AGACCCAGGCAGAAGCTGCAAGG - Intergenic
1007820350 6:44556165-44556187 TCCTAGAGGCAGAAGGTGCAAGG + Intergenic
1008532049 6:52471204-52471226 TGTCAAAGGCAGAAGCTCCTGGG + Intronic
1008939288 6:57029148-57029170 TCTTGCAGCCAGAGGCTGCATGG - Intergenic
1009717148 6:67412440-67412462 TCTTGCAGTCAGAGGCTGCATGG - Intergenic
1011340885 6:86313167-86313189 TGTTCCTGGCAGAGGCTGCATGG + Intergenic
1013561149 6:111306270-111306292 TGTTCCTGGCAGAAGGAGCAGGG + Intronic
1017593063 6:155997624-155997646 TTTTGCAGGCAGAAGATGGAAGG + Intergenic
1017727746 6:157287432-157287454 TTTTACAGCCAGAGGCTGCAAGG - Intergenic
1018378804 6:163239525-163239547 TGTAGCAGGGAGAAGCAGCAAGG - Intronic
1018584440 6:165340735-165340757 TGCTCCAGGCAGAGACTGCAGGG + Intronic
1022206155 7:28165618-28165640 TGTTCCAGGCAGAGGCTGCAAGG - Intronic
1022530012 7:31061209-31061231 TGTTGCAGGCAGATCCTGCAAGG - Intronic
1023519925 7:41039758-41039780 TGCTGCAGCCAGAGGCTGCAGGG - Intergenic
1024259481 7:47563156-47563178 GGTCACAGCCAGGAGCTGCATGG + Intronic
1024753698 7:52502590-52502612 AGTTACAGGAAGAAGATGTAGGG + Intergenic
1026285671 7:68960715-68960737 TATTACAGCCAGAAGCTTGAGGG - Intergenic
1026376290 7:69754254-69754276 TGTTACATACAGAGGCTCCAAGG + Intronic
1026534695 7:71230014-71230036 TGTGTTAGGCAGAGGCTGCAAGG + Intronic
1029183555 7:98721909-98721931 TGATACAAGCAGAGGCGGCAGGG + Intergenic
1029789429 7:102827136-102827158 GGCTAAAGGTAGAAGCTGCAAGG - Intronic
1029835766 7:103308132-103308154 TGTTAGAGCCAGAACTTGCAGGG + Intronic
1030356030 7:108543339-108543361 AGGCCCAGGCAGAAGCTGCAAGG + Intronic
1031229823 7:119092162-119092184 GATTACAGGCATGAGCTGCACGG - Intergenic
1032465017 7:132138738-132138760 TGTGACCTGCAGCAGCTGCATGG + Intronic
1032857280 7:135845924-135845946 TGGTACAAGGAGAACCTGCATGG + Intergenic
1034738038 7:153447148-153447170 TGTTTCAGTCAGAAGTTGGAAGG + Intergenic
1034788795 7:153949310-153949332 TGTTAACGGAAGAAGCTTCAGGG - Intronic
1035439091 7:158881119-158881141 TGTTAGGAGCAGAAGCTGCCTGG + Intronic
1036644085 8:10601325-10601347 AGTTGCAGGCAGAAGCAGCATGG + Intergenic
1037321942 8:17652144-17652166 TACTAAAGGCAGAAGCAGCAAGG + Intronic
1037748643 8:21665714-21665736 TGCTTCAGGCAGAAGCTACTGGG - Intergenic
1037966514 8:23138240-23138262 AGGAACAGGCAGAAGCTGAAGGG - Exonic
1041421307 8:57669859-57669881 AGAGACTGGCAGAAGCTGCATGG - Intergenic
1041433335 8:57809112-57809134 TGTTACAGGGAGCAGCGACAGGG - Intergenic
1042399028 8:68324686-68324708 TGTTTCAGGCTTAGGCTGCAAGG + Intronic
1043076701 8:75710347-75710369 TGTTACAGACATAGGCTGCTAGG + Intergenic
1046648690 8:116813341-116813363 TGTCACATGCTGATGCTGCAGGG + Intronic
1047015302 8:120717802-120717824 TGTTAAAGGAAGGATCTGCAGGG + Intronic
1047269658 8:123343928-123343950 TATTCCAGGCAGAAGCAGTATGG + Intronic
1047449433 8:124950867-124950889 AGTCGCAGGCAGAAGCTGCAAGG - Intergenic
1048663917 8:136639468-136639490 TGTCTCAGGCACAAACTGCAAGG + Intergenic
1048736571 8:137508646-137508668 TGTTACAGACACAAGTTGCGAGG - Intergenic
1049268787 8:141683377-141683399 TGCTCCAGGGGGAAGCTGCAGGG - Intergenic
1050756569 9:9011599-9011621 TGTAAGAGGCAGAATCTTCAGGG - Intronic
1051349180 9:16183038-16183060 TCTTTAAAGCAGAAGCTGCAGGG - Intergenic
1052548305 9:29909892-29909914 TGTAACTGGCAGAGGCTGAAAGG + Intergenic
1056111161 9:83396455-83396477 TGGTACAGGCATAAGCCTCAAGG + Intronic
1056177330 9:84048378-84048400 TGTTATAGGCAGAAGAGGCCTGG + Intergenic
1056801755 9:89697020-89697042 TGTCACTGGCAGCAGCTGCTAGG + Intergenic
1058752183 9:108050420-108050442 TGTTACAGGGAGAAGGTGAAAGG + Intergenic
1061861799 9:133472199-133472221 GGTCACAGGGAGAAGCTCCAGGG + Intronic
1062726418 9:138076499-138076521 AGTAACAGGCAGAACCTGGAGGG + Intronic
1187566029 X:20450479-20450501 AGATAAAGGCAGAAGCTTCACGG + Intergenic
1189251672 X:39605115-39605137 TGTTCCCAGCAGAAGCTGCAAGG + Intergenic
1189288502 X:39868752-39868774 TGGGACTGGGAGAAGCTGCAGGG + Intergenic
1189479295 X:41380745-41380767 AGAAACAGGCAGATGCTGCACGG + Intergenic
1189511497 X:41666831-41666853 AGTAACACGAAGAAGCTGCAGGG + Intronic
1190017660 X:46841601-46841623 AGAGACTGGCAGAAGCTGCATGG + Intronic
1190276378 X:48902168-48902190 TGTTGAAGGCAGAGGCTGCTGGG + Intronic
1190876763 X:54465591-54465613 TGTGACAGGCAGAAGCAGAGGGG + Intronic
1191728408 X:64306338-64306360 CTTTACAGTTAGAAGCTGCATGG - Intronic
1192780312 X:74287383-74287405 TGTTACAGCCAGCAGCAGCCTGG - Intergenic
1193148596 X:78102759-78102781 TCTTGCAGCCAGAGGCTGCATGG - Intronic
1193237948 X:79131650-79131672 TTTTAGAGGCAGAGGGTGCAAGG - Intergenic
1195244012 X:102979895-102979917 TGTCACAGGAAGAAGCTACTGGG - Intergenic
1195676789 X:107512779-107512801 TGTCACTGGCAGAGGCAGCAAGG - Intergenic
1198028120 X:132728949-132728971 TGATACAGGCTGAAGGTGGAGGG - Intronic
1199353390 X:146831801-146831823 TGTGACAGGAAGCAGCAGCAAGG + Intergenic
1199566188 X:149217729-149217751 TTTTACAGGCTCAAGCTGGAAGG + Intergenic
1200700437 Y:6397717-6397739 TGGTACAGGCAGAGCCTGCCTGG + Intergenic
1200820616 Y:7578973-7578995 TCTTCCAGGAAGAACCTGCAAGG - Intergenic
1200916242 Y:8573665-8573687 TGTTACAGGCAGAGCCAGCCTGG - Intergenic
1200930053 Y:8688801-8688823 TGGTACAGGCAGAACCAGCATGG + Intergenic
1200931224 Y:8698855-8698877 TGGTACAGGCAGAACCTGCCTGG + Intergenic
1200935251 Y:8732795-8732817 TCATACAGGCAGAATCTGCATGG + Intergenic
1200960451 Y:8991527-8991549 TGTTACAGGCAGAGCCAGCCTGG - Intergenic
1201031532 Y:9749918-9749940 TGGTACAGGCAGAACCTGCCTGG - Intergenic
1201033675 Y:9766981-9767003 TGGTACAGGCAGAGCCTGCCTGG - Intergenic
1202177164 Y:22108497-22108519 TGGTACAGGCAGAATCTGCCTGG + Intergenic
1202189050 Y:22222089-22222111 TCTTCCAGGAAGAAACTGCAAGG - Intergenic
1202214197 Y:22477887-22477909 TGGTACAGGCAGAATCTGCCTGG - Intergenic
1202239691 Y:22753769-22753791 TCTTCCAGGAAGAACCTGCAAGG + Intergenic
1202392676 Y:24387531-24387553 TCTTCCAGGAAGAACCTGCAAGG + Intergenic
1202478106 Y:25282586-25282608 TCTTCCAGGAAGAACCTGCAAGG - Intergenic