ID: 1175378092

View in Genome Browser
Species Human (GRCh38)
Location 20:58543034-58543056
Sequence GGGACGGACACCATCATCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175378092_1175378100 14 Left 1175378092 20:58543034-58543056 CCAAAGATGATGGTGTCCGTCCC No data
Right 1175378100 20:58543071-58543093 CATGTTTTGCTGGCCTTTACTGG No data
1175378092_1175378099 4 Left 1175378092 20:58543034-58543056 CCAAAGATGATGGTGTCCGTCCC No data
Right 1175378099 20:58543061-58543083 GGAGACTGGACATGTTTTGCTGG No data
1175378092_1175378094 -10 Left 1175378092 20:58543034-58543056 CCAAAGATGATGGTGTCCGTCCC No data
Right 1175378094 20:58543047-58543069 TGTCCGTCCCCTTTGGAGACTGG No data
1175378092_1175378102 28 Left 1175378092 20:58543034-58543056 CCAAAGATGATGGTGTCCGTCCC No data
Right 1175378102 20:58543085-58543107 CTTTACTGGAACACAGCCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175378092 Original CRISPR GGGACGGACACCATCATCTT TGG (reversed) Intergenic