ID: 1175378095

View in Genome Browser
Species Human (GRCh38)
Location 20:58543050-58543072
Sequence TGTCCAGTCTCCAAAGGGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175378095_1175378103 26 Left 1175378095 20:58543050-58543072 CCGTCCCCTTTGGAGACTGGACA No data
Right 1175378103 20:58543099-58543121 AGCCACCGGATCCCTGCAGATGG No data
1175378095_1175378100 -2 Left 1175378095 20:58543050-58543072 CCGTCCCCTTTGGAGACTGGACA No data
Right 1175378100 20:58543071-58543093 CATGTTTTGCTGGCCTTTACTGG No data
1175378095_1175378102 12 Left 1175378095 20:58543050-58543072 CCGTCCCCTTTGGAGACTGGACA No data
Right 1175378102 20:58543085-58543107 CTTTACTGGAACACAGCCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175378095 Original CRISPR TGTCCAGTCTCCAAAGGGGA CGG (reversed) Intergenic
No off target data available for this crispr