ID: 1175378096

View in Genome Browser
Species Human (GRCh38)
Location 20:58543054-58543076
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175378096_1175378107 28 Left 1175378096 20:58543054-58543076 CCCCTTTGGAGACTGGACATGTT No data
Right 1175378107 20:58543105-58543127 CGGATCCCTGCAGATGGCTAGGG No data
1175378096_1175378102 8 Left 1175378096 20:58543054-58543076 CCCCTTTGGAGACTGGACATGTT No data
Right 1175378102 20:58543085-58543107 CTTTACTGGAACACAGCCACCGG No data
1175378096_1175378106 27 Left 1175378096 20:58543054-58543076 CCCCTTTGGAGACTGGACATGTT No data
Right 1175378106 20:58543104-58543126 CCGGATCCCTGCAGATGGCTAGG No data
1175378096_1175378100 -6 Left 1175378096 20:58543054-58543076 CCCCTTTGGAGACTGGACATGTT No data
Right 1175378100 20:58543071-58543093 CATGTTTTGCTGGCCTTTACTGG No data
1175378096_1175378103 22 Left 1175378096 20:58543054-58543076 CCCCTTTGGAGACTGGACATGTT No data
Right 1175378103 20:58543099-58543121 AGCCACCGGATCCCTGCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175378096 Original CRISPR AACATGTCCAGTCTCCAAAG GGG (reversed) Intergenic