ID: 1175378098

View in Genome Browser
Species Human (GRCh38)
Location 20:58543056-58543078
Sequence AAAACATGTCCAGTCTCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175378098_1175378100 -8 Left 1175378098 20:58543056-58543078 CCTTTGGAGACTGGACATGTTTT No data
Right 1175378100 20:58543071-58543093 CATGTTTTGCTGGCCTTTACTGG No data
1175378098_1175378107 26 Left 1175378098 20:58543056-58543078 CCTTTGGAGACTGGACATGTTTT No data
Right 1175378107 20:58543105-58543127 CGGATCCCTGCAGATGGCTAGGG No data
1175378098_1175378106 25 Left 1175378098 20:58543056-58543078 CCTTTGGAGACTGGACATGTTTT No data
Right 1175378106 20:58543104-58543126 CCGGATCCCTGCAGATGGCTAGG No data
1175378098_1175378103 20 Left 1175378098 20:58543056-58543078 CCTTTGGAGACTGGACATGTTTT No data
Right 1175378103 20:58543099-58543121 AGCCACCGGATCCCTGCAGATGG No data
1175378098_1175378102 6 Left 1175378098 20:58543056-58543078 CCTTTGGAGACTGGACATGTTTT No data
Right 1175378102 20:58543085-58543107 CTTTACTGGAACACAGCCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175378098 Original CRISPR AAAACATGTCCAGTCTCCAA AGG (reversed) Intergenic