ID: 1175378099

View in Genome Browser
Species Human (GRCh38)
Location 20:58543061-58543083
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175378092_1175378099 4 Left 1175378092 20:58543034-58543056 CCAAAGATGATGGTGTCCGTCCC No data
Right 1175378099 20:58543061-58543083 GGAGACTGGACATGTTTTGCTGG No data
1175378090_1175378099 26 Left 1175378090 20:58543012-58543034 CCTTTGAAGCGTGACATGAATGC No data
Right 1175378099 20:58543061-58543083 GGAGACTGGACATGTTTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175378099 Original CRISPR GGAGACTGGACATGTTTTGC TGG Intergenic