ID: 1175378100

View in Genome Browser
Species Human (GRCh38)
Location 20:58543071-58543093
Sequence CATGTTTTGCTGGCCTTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175378092_1175378100 14 Left 1175378092 20:58543034-58543056 CCAAAGATGATGGTGTCCGTCCC 0: 1
1: 0
2: 0
3: 2
4: 59
Right 1175378100 20:58543071-58543093 CATGTTTTGCTGGCCTTTACTGG No data
1175378096_1175378100 -6 Left 1175378096 20:58543054-58543076 CCCCTTTGGAGACTGGACATGTT No data
Right 1175378100 20:58543071-58543093 CATGTTTTGCTGGCCTTTACTGG No data
1175378095_1175378100 -2 Left 1175378095 20:58543050-58543072 CCGTCCCCTTTGGAGACTGGACA No data
Right 1175378100 20:58543071-58543093 CATGTTTTGCTGGCCTTTACTGG No data
1175378098_1175378100 -8 Left 1175378098 20:58543056-58543078 CCTTTGGAGACTGGACATGTTTT No data
Right 1175378100 20:58543071-58543093 CATGTTTTGCTGGCCTTTACTGG No data
1175378097_1175378100 -7 Left 1175378097 20:58543055-58543077 CCCTTTGGAGACTGGACATGTTT No data
Right 1175378100 20:58543071-58543093 CATGTTTTGCTGGCCTTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175378100 Original CRISPR CATGTTTTGCTGGCCTTTAC TGG Intergenic