ID: 1175378101

View in Genome Browser
Species Human (GRCh38)
Location 20:58543084-58543106
Sequence CGGTGGCTGTGTTCCAGTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175378101_1175378107 -2 Left 1175378101 20:58543084-58543106 CCTTTACTGGAACACAGCCACCG No data
Right 1175378107 20:58543105-58543127 CGGATCCCTGCAGATGGCTAGGG No data
1175378101_1175378110 21 Left 1175378101 20:58543084-58543106 CCTTTACTGGAACACAGCCACCG No data
Right 1175378110 20:58543128-58543150 CTTCCTGAGCTACCTGTTTGAGG No data
1175378101_1175378113 27 Left 1175378101 20:58543084-58543106 CCTTTACTGGAACACAGCCACCG No data
Right 1175378113 20:58543134-58543156 GAGCTACCTGTTTGAGGGAGCGG No data
1175378101_1175378106 -3 Left 1175378101 20:58543084-58543106 CCTTTACTGGAACACAGCCACCG No data
Right 1175378106 20:58543104-58543126 CCGGATCCCTGCAGATGGCTAGG No data
1175378101_1175378114 28 Left 1175378101 20:58543084-58543106 CCTTTACTGGAACACAGCCACCG No data
Right 1175378114 20:58543135-58543157 AGCTACCTGTTTGAGGGAGCGGG No data
1175378101_1175378111 22 Left 1175378101 20:58543084-58543106 CCTTTACTGGAACACAGCCACCG No data
Right 1175378111 20:58543129-58543151 TTCCTGAGCTACCTGTTTGAGGG No data
1175378101_1175378103 -8 Left 1175378101 20:58543084-58543106 CCTTTACTGGAACACAGCCACCG No data
Right 1175378103 20:58543099-58543121 AGCCACCGGATCCCTGCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175378101 Original CRISPR CGGTGGCTGTGTTCCAGTAA AGG (reversed) Intergenic