ID: 1175378102

View in Genome Browser
Species Human (GRCh38)
Location 20:58543085-58543107
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175378097_1175378102 7 Left 1175378097 20:58543055-58543077 CCCTTTGGAGACTGGACATGTTT No data
Right 1175378102 20:58543085-58543107 CTTTACTGGAACACAGCCACCGG No data
1175378095_1175378102 12 Left 1175378095 20:58543050-58543072 CCGTCCCCTTTGGAGACTGGACA No data
Right 1175378102 20:58543085-58543107 CTTTACTGGAACACAGCCACCGG No data
1175378096_1175378102 8 Left 1175378096 20:58543054-58543076 CCCCTTTGGAGACTGGACATGTT No data
Right 1175378102 20:58543085-58543107 CTTTACTGGAACACAGCCACCGG No data
1175378098_1175378102 6 Left 1175378098 20:58543056-58543078 CCTTTGGAGACTGGACATGTTTT No data
Right 1175378102 20:58543085-58543107 CTTTACTGGAACACAGCCACCGG No data
1175378092_1175378102 28 Left 1175378092 20:58543034-58543056 CCAAAGATGATGGTGTCCGTCCC No data
Right 1175378102 20:58543085-58543107 CTTTACTGGAACACAGCCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175378102 Original CRISPR CTTTACTGGAACACAGCCAC CGG Intergenic