ID: 1175378103

View in Genome Browser
Species Human (GRCh38)
Location 20:58543099-58543121
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175378096_1175378103 22 Left 1175378096 20:58543054-58543076 CCCCTTTGGAGACTGGACATGTT No data
Right 1175378103 20:58543099-58543121 AGCCACCGGATCCCTGCAGATGG No data
1175378095_1175378103 26 Left 1175378095 20:58543050-58543072 CCGTCCCCTTTGGAGACTGGACA No data
Right 1175378103 20:58543099-58543121 AGCCACCGGATCCCTGCAGATGG No data
1175378098_1175378103 20 Left 1175378098 20:58543056-58543078 CCTTTGGAGACTGGACATGTTTT No data
Right 1175378103 20:58543099-58543121 AGCCACCGGATCCCTGCAGATGG No data
1175378101_1175378103 -8 Left 1175378101 20:58543084-58543106 CCTTTACTGGAACACAGCCACCG No data
Right 1175378103 20:58543099-58543121 AGCCACCGGATCCCTGCAGATGG No data
1175378097_1175378103 21 Left 1175378097 20:58543055-58543077 CCCTTTGGAGACTGGACATGTTT No data
Right 1175378103 20:58543099-58543121 AGCCACCGGATCCCTGCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175378103 Original CRISPR AGCCACCGGATCCCTGCAGA TGG Intergenic