ID: 1175378104

View in Genome Browser
Species Human (GRCh38)
Location 20:58543101-58543123
Sequence AGCCATCTGCAGGGATCCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175378104_1175378113 10 Left 1175378104 20:58543101-58543123 CCACCGGATCCCTGCAGATGGCT No data
Right 1175378113 20:58543134-58543156 GAGCTACCTGTTTGAGGGAGCGG No data
1175378104_1175378116 24 Left 1175378104 20:58543101-58543123 CCACCGGATCCCTGCAGATGGCT No data
Right 1175378116 20:58543148-58543170 AGGGAGCGGGCCCCCAGCCCCGG No data
1175378104_1175378119 27 Left 1175378104 20:58543101-58543123 CCACCGGATCCCTGCAGATGGCT No data
Right 1175378119 20:58543151-58543173 GAGCGGGCCCCCAGCCCCGGGGG No data
1175378104_1175378114 11 Left 1175378104 20:58543101-58543123 CCACCGGATCCCTGCAGATGGCT No data
Right 1175378114 20:58543135-58543157 AGCTACCTGTTTGAGGGAGCGGG No data
1175378104_1175378111 5 Left 1175378104 20:58543101-58543123 CCACCGGATCCCTGCAGATGGCT No data
Right 1175378111 20:58543129-58543151 TTCCTGAGCTACCTGTTTGAGGG No data
1175378104_1175378120 28 Left 1175378104 20:58543101-58543123 CCACCGGATCCCTGCAGATGGCT No data
Right 1175378120 20:58543152-58543174 AGCGGGCCCCCAGCCCCGGGGGG No data
1175378104_1175378118 26 Left 1175378104 20:58543101-58543123 CCACCGGATCCCTGCAGATGGCT No data
Right 1175378118 20:58543150-58543172 GGAGCGGGCCCCCAGCCCCGGGG No data
1175378104_1175378110 4 Left 1175378104 20:58543101-58543123 CCACCGGATCCCTGCAGATGGCT No data
Right 1175378110 20:58543128-58543150 CTTCCTGAGCTACCTGTTTGAGG No data
1175378104_1175378117 25 Left 1175378104 20:58543101-58543123 CCACCGGATCCCTGCAGATGGCT No data
Right 1175378117 20:58543149-58543171 GGGAGCGGGCCCCCAGCCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175378104 Original CRISPR AGCCATCTGCAGGGATCCGG TGG (reversed) Intergenic
No off target data available for this crispr