ID: 1175378107

View in Genome Browser
Species Human (GRCh38)
Location 20:58543105-58543127
Sequence CGGATCCCTGCAGATGGCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175378101_1175378107 -2 Left 1175378101 20:58543084-58543106 CCTTTACTGGAACACAGCCACCG No data
Right 1175378107 20:58543105-58543127 CGGATCCCTGCAGATGGCTAGGG No data
1175378098_1175378107 26 Left 1175378098 20:58543056-58543078 CCTTTGGAGACTGGACATGTTTT No data
Right 1175378107 20:58543105-58543127 CGGATCCCTGCAGATGGCTAGGG No data
1175378096_1175378107 28 Left 1175378096 20:58543054-58543076 CCCCTTTGGAGACTGGACATGTT No data
Right 1175378107 20:58543105-58543127 CGGATCCCTGCAGATGGCTAGGG No data
1175378097_1175378107 27 Left 1175378097 20:58543055-58543077 CCCTTTGGAGACTGGACATGTTT No data
Right 1175378107 20:58543105-58543127 CGGATCCCTGCAGATGGCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175378107 Original CRISPR CGGATCCCTGCAGATGGCTA GGG Intergenic
No off target data available for this crispr