ID: 1175378108

View in Genome Browser
Species Human (GRCh38)
Location 20:58543110-58543132
Sequence GGAAGCCCTAGCCATCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175378108_1175378111 -4 Left 1175378108 20:58543110-58543132 CCCTGCAGATGGCTAGGGCTTCC No data
Right 1175378111 20:58543129-58543151 TTCCTGAGCTACCTGTTTGAGGG No data
1175378108_1175378118 17 Left 1175378108 20:58543110-58543132 CCCTGCAGATGGCTAGGGCTTCC No data
Right 1175378118 20:58543150-58543172 GGAGCGGGCCCCCAGCCCCGGGG No data
1175378108_1175378113 1 Left 1175378108 20:58543110-58543132 CCCTGCAGATGGCTAGGGCTTCC No data
Right 1175378113 20:58543134-58543156 GAGCTACCTGTTTGAGGGAGCGG No data
1175378108_1175378114 2 Left 1175378108 20:58543110-58543132 CCCTGCAGATGGCTAGGGCTTCC No data
Right 1175378114 20:58543135-58543157 AGCTACCTGTTTGAGGGAGCGGG No data
1175378108_1175378117 16 Left 1175378108 20:58543110-58543132 CCCTGCAGATGGCTAGGGCTTCC No data
Right 1175378117 20:58543149-58543171 GGGAGCGGGCCCCCAGCCCCGGG No data
1175378108_1175378120 19 Left 1175378108 20:58543110-58543132 CCCTGCAGATGGCTAGGGCTTCC No data
Right 1175378120 20:58543152-58543174 AGCGGGCCCCCAGCCCCGGGGGG No data
1175378108_1175378119 18 Left 1175378108 20:58543110-58543132 CCCTGCAGATGGCTAGGGCTTCC No data
Right 1175378119 20:58543151-58543173 GAGCGGGCCCCCAGCCCCGGGGG No data
1175378108_1175378116 15 Left 1175378108 20:58543110-58543132 CCCTGCAGATGGCTAGGGCTTCC No data
Right 1175378116 20:58543148-58543170 AGGGAGCGGGCCCCCAGCCCCGG No data
1175378108_1175378110 -5 Left 1175378108 20:58543110-58543132 CCCTGCAGATGGCTAGGGCTTCC No data
Right 1175378110 20:58543128-58543150 CTTCCTGAGCTACCTGTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175378108 Original CRISPR GGAAGCCCTAGCCATCTGCA GGG (reversed) Intergenic