ID: 1175378113

View in Genome Browser
Species Human (GRCh38)
Location 20:58543134-58543156
Sequence GAGCTACCTGTTTGAGGGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175378108_1175378113 1 Left 1175378108 20:58543110-58543132 CCCTGCAGATGGCTAGGGCTTCC No data
Right 1175378113 20:58543134-58543156 GAGCTACCTGTTTGAGGGAGCGG No data
1175378104_1175378113 10 Left 1175378104 20:58543101-58543123 CCACCGGATCCCTGCAGATGGCT No data
Right 1175378113 20:58543134-58543156 GAGCTACCTGTTTGAGGGAGCGG No data
1175378105_1175378113 7 Left 1175378105 20:58543104-58543126 CCGGATCCCTGCAGATGGCTAGG No data
Right 1175378113 20:58543134-58543156 GAGCTACCTGTTTGAGGGAGCGG No data
1175378109_1175378113 0 Left 1175378109 20:58543111-58543133 CCTGCAGATGGCTAGGGCTTCCT No data
Right 1175378113 20:58543134-58543156 GAGCTACCTGTTTGAGGGAGCGG No data
1175378101_1175378113 27 Left 1175378101 20:58543084-58543106 CCTTTACTGGAACACAGCCACCG No data
Right 1175378113 20:58543134-58543156 GAGCTACCTGTTTGAGGGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175378113 Original CRISPR GAGCTACCTGTTTGAGGGAG CGG Intergenic
No off target data available for this crispr