ID: 1175380970

View in Genome Browser
Species Human (GRCh38)
Location 20:58563989-58564011
Sequence AGTGTTGACGAGGATGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175380967_1175380970 13 Left 1175380967 20:58563953-58563975 CCAGAATGGCTAAAATTAAAAAG 0: 23
1: 99
2: 313
3: 753
4: 1331
Right 1175380970 20:58563989-58564011 AGTGTTGACGAGGATGTGGAAGG No data
1175380966_1175380970 25 Left 1175380966 20:58563941-58563963 CCACTATGCTTGCCAGAATGGCT No data
Right 1175380970 20:58563989-58564011 AGTGTTGACGAGGATGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175380970 Original CRISPR AGTGTTGACGAGGATGTGGA AGG Intergenic
No off target data available for this crispr