ID: 1175381838

View in Genome Browser
Species Human (GRCh38)
Location 20:58568953-58568975
Sequence AGAGCTGTTTTTGGCAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175381838_1175381844 29 Left 1175381838 20:58568953-58568975 CCAGCACTGCCAAAAACAGCTCT No data
Right 1175381844 20:58569005-58569027 TTCCTTCTGCCACCCAGGAGAGG No data
1175381838_1175381843 24 Left 1175381838 20:58568953-58568975 CCAGCACTGCCAAAAACAGCTCT No data
Right 1175381843 20:58569000-58569022 TAACTTTCCTTCTGCCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175381838 Original CRISPR AGAGCTGTTTTTGGCAGTGC TGG (reversed) Intergenic
No off target data available for this crispr