ID: 1175381839

View in Genome Browser
Species Human (GRCh38)
Location 20:58568962-58568984
Sequence TCTAGCGGGAGAGCTGTTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175381839_1175381843 15 Left 1175381839 20:58568962-58568984 CCAAAAACAGCTCTCCCGCTAGA No data
Right 1175381843 20:58569000-58569022 TAACTTTCCTTCTGCCACCCAGG No data
1175381839_1175381844 20 Left 1175381839 20:58568962-58568984 CCAAAAACAGCTCTCCCGCTAGA No data
Right 1175381844 20:58569005-58569027 TTCCTTCTGCCACCCAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175381839 Original CRISPR TCTAGCGGGAGAGCTGTTTT TGG (reversed) Intergenic
No off target data available for this crispr