ID: 1175381843

View in Genome Browser
Species Human (GRCh38)
Location 20:58569000-58569022
Sequence TAACTTTCCTTCTGCCACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175381839_1175381843 15 Left 1175381839 20:58568962-58568984 CCAAAAACAGCTCTCCCGCTAGA No data
Right 1175381843 20:58569000-58569022 TAACTTTCCTTCTGCCACCCAGG No data
1175381841_1175381843 0 Left 1175381841 20:58568977-58568999 CCGCTAGATTTATAAAGTTTGCC No data
Right 1175381843 20:58569000-58569022 TAACTTTCCTTCTGCCACCCAGG No data
1175381840_1175381843 1 Left 1175381840 20:58568976-58568998 CCCGCTAGATTTATAAAGTTTGC No data
Right 1175381843 20:58569000-58569022 TAACTTTCCTTCTGCCACCCAGG No data
1175381838_1175381843 24 Left 1175381838 20:58568953-58568975 CCAGCACTGCCAAAAACAGCTCT No data
Right 1175381843 20:58569000-58569022 TAACTTTCCTTCTGCCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175381843 Original CRISPR TAACTTTCCTTCTGCCACCC AGG Intergenic
No off target data available for this crispr